Busch Lab

ZMP

ampd2

Ensembl ID:
ENSDARG00000029952
ZFIN ID:
ZDB-GENE-070713-5
Description:
Adenosine monophosphate deaminase 2 (Isoform L) [Source:UniProtKB/TrEMBL;Acc:B8JIS2]
Human Orthologue:
AMPD2
Human Description:
adenosine monophosphate deaminase 2 [Source:HGNC Symbol;Acc:469]
Mouse Orthologue:
Ampd2
Mouse Description:
adenosine monophosphate deaminase 2 Gene [Source:MGI Symbol;Acc:MGI:88016]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa2452 Nonsense F2 line generated Not yet available
sa21296 Nonsense Available for shipment Available now
sa16131 Nonsense Available for shipment Available now
sa10749 Essential Splice Site Available for shipment Available now
sa872 Nonsense Available for shipment Available now
sa7613 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa2452
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 Nonsense 64 230 2 6
ENSDART00000093090 Nonsense 40 793 1 17
ENSDART00000121932 Nonsense 64 334 2 9
ENSDART00000143554 Nonsense 6 756 2 18
Genomic Location (Zv9):
Chromosome 8 (position 26120861)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25248779
GRCz11 8 25267918
KASP Assay ID:
554-3166.1 (used for ordering genotyping assays)
KASP Sequence:
TAACCAAGCAYGGCCACATTGACCTACGCACCTCCATGGATGGCAAATAC[A/T]AAGAGATTGCAGAGGTAAACAAAGCACAAATCACAACACCGACTCTTGAT
Long Flanking Sequence:
ACTTTAGTAAACATTTTAGAAAACATTTTATAAACTGTGTTTTTACAGCGTGGGCGCTAGATGCATTTGGTCTTTACTTGCCCACAAGTTAAGTTGGCATTCTAAGACAAAGGCACAGCACACACTCACATATAAACTAATATCCTCCCACTTGAATGCTCCATTGTTTTTTGAGACAATTGGACAAACAGTTGCAGATCTTCGTCAGCTTTCTGACCCTGCCTTTCTCTGGACAGCAGAAAAACAACGCTATATATAATTGAACACAATCAATGTTGTCATTTTGGCTTAAACATTTTTCTCTATACTTACATCTTACAATCTGAATGTTTTAAATATGAAAACCATCTCAGTTAAAATATAAAGATGTCTTTCTCACTGTCTTATTAGTAGATCTCCGTGTTGGCAGACACCTTCTCACATCCCAGTATTCATTGCCTGGCAACCCTGTAACCAAGCACGGCCACATTGACCTACGCACCTCCATGGATGGCAAATAC[A/T]AAGAGATTGCAGAGGTAAACAAAGCACAAATCACAACACCGACTCTTGATGCCTTTGAATGCCACCCTGACCCAAATGTCTGGTGTTTTAGATTTATTATATATTTCTTTTACAATCTTTTTATTGACAATATGCAATAAAAAATATGACAATATAACATCACAATCATATTTACATCCTTGTTTTCAATTTAGAGGAAAAAACTAAAATATTGAGGAAACAAAAGCAAAAAAGGGATAAAAAAATTAATAAAAAAGGAAAAGGGGGGGGGGGCACAGGCTGTTTGAATAAATCTTTGGAAATCGGGGGAATATGTAGATAGGTAGTTTATTTTGTCTTTTCCTGTTTCATTAAATAAATTGCTGAAACTTGAGTGTCCACATTTTCTCAAAAACAGTAAGTTTGCATTTTGTATTTTGTATTTCTAACAATATCAGCAAAAAAAATGTGTAAACTAGTACTAGGTTTGTATAAATGTAAAAAGTGATAGAAAAAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21296
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 Nonsense 120 230 4 6
ENSDART00000093090 Nonsense 96 793 3 17
ENSDART00000121932 Nonsense 120 334 4 9
ENSDART00000143554 Nonsense 62 756 4 18
Genomic Location (Zv9):
Chromosome 8 (position 26123658)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25251576
GRCz11 8 25270715
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTTAATTAAATGCTTATTCTCTTGAGGTTTGAGCCTGATATCCTTCTA[C/T]GAGCCAAACAGGACTTCATGAAAACAGACAGCGCTACGGACCTGGAGTGA
Long Flanking Sequence:
TTCCATTTGCTAAAACACAGAGAGAGTTGTGCACAAATTAAGACTCAAAATTACTCCAGAGTGGATAAAAACATCCCCAAAAGCACACAAGGGTTAATCCCAAATTTCTTAAGCTAACAAATTGTTATGATCTCAGTATTTAACTAACAAAAATGTCTAGCTTAAAACTGGTGTAGAAGCAAAGTTTTGCTGGTAAAGTTCCAACTGGCTAACCAGAATTATTATAGCTAACTATTAAAAAACAATAAAACGTGTATATCTTTTGTTAAACTTTTTGAAAACCTGAATCTCAAGTTGTAGTCGAGCAGCCATACCAAAACACAACCTGAAAATCAGTCTAATGTTCATCTGCATTAGCTTTTTCAGCTGGGAATTTGAAATATACTCCTGAATGCATGAGCCAATGTTAGTCCAGCATTTATTGGACTGTATGCACATGTGAACCACAGAAAGTTAATTAAATGCTTATTCTCTTGAGGTTTGAGCCTGATATCCTTCTA[C/T]GAGCCAAACAGGACTTCATGAAAACAGACAGCGCTACGGACCTGGAGTGAGTGCCTTTAACATCTTCTGTGATGATCGCTGTTTGTTGACTAATCCACTAGATAAGTCTGACATCACATGCCATAGTTTCTGGGTCCAAAATCGACAACAAATGGTAGTAACCTAGCTAACAGGAAACATTCTGTAACCTTTGATAAAGGTTTTCTAAGTTTTAATTTGTAATGTTATTAAAGTTGTGCATTTGGAACCATTCTTGTAACATTGATAGAAAAACGTTCCTAAAACATTAATATGATGTGGAAGAAATGTTCGAATAACCTTTTAAATAATGTTGTAAGAACATGAAAAGAACATGAAACCTTATGAAAATGCTGAGAATAATGTTATTATAATAAAAAAATTATGTTATTTACATAATCTAAAAGATTGATCTTTTGAACCTACTAAGAACAATTGAAAAATGAATTATATATAACTAAATGAGAACATTAAGAGAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16131
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 Nonsense 148 230 5 6
ENSDART00000093090 Nonsense 124 793 4 17
ENSDART00000121932 Nonsense 148 334 5 9
ENSDART00000143554 Nonsense 90 756 5 18
Genomic Location (Zv9):
Chromosome 8 (position 26124472)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25252390
GRCz11 8 25271529
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTTTTTCAGGTATATGAAAGAACAGAGCCAGACACCCATAGAAAACTA[T/A]CCCGAGAGAGAGCTYATCCCRGAGAGAGAGTACCAGAGAGTCACTATCTC
Long Flanking Sequence:
ATAACCTTTTAAATAATGTTGTAAGAACATGAAAAGAACATGAAACCTTATGAAAATGCTGAGAATAATGTTATTATAATAAAAAAATTATGTTATTTACATAATCTAAAAGATTGATCTTTTGAACCTACTAAGAACAATTGAAAAATGAATTATATATAACTAAATGAGAACATTAAGAGAGTGTTTTTTTGCAACCTTAAATTGTTAGCAGGAAGTATATACTTACAGTTTGGTGTGCATAATGTTTATAACCATGTCTAATTTCAAATGGTCCATATTTTGTAAATGGGTTGAGCAAAATCATCATAAAGATTTGCTTAAATGTGTCTATGACTACATGACTAAACAGTAGTCATAAACGGCTATGGGCTATTGAGATTTTTAATTCAAATGAGTACTTAGAGTATTTCATGGATCAAAACTTAACAAGCACATTGTATCTCTTGTTTTTTTTTCAGGTATATGAAAGAACAGAGCCAGACACCCATAGAAAACTA[T/A]CCCGAGAGAGAGCTTATCCCGGAGAGAGAGTACCAGAGAGTCACTATCTCTGGAGAGGAGAAGTGTGGGGTACAGACAGACCTCTTCAGCTTTGTTTATTACACTAAAACAAGATGTTGTTGAGAGAACTGGAGTGGACACTGCAGACATTACATAAACTCCTCAGGGAGAAATATTTCTCACACATACACACACACACACAAATACACAAACCCCAGCGGAAACAGGCTGACAGCAATGCAGCTGAAGAGTTTTCACATAAACTTATGAAGAAAAATGAGCAGAAAAGTTTTTCTTTTATATTTATATATATTCATAAAACTAAAATCATGTTTGACTCGAATAAAATTGACATATATTAGACAAATATAATACATATAAAGCAAAAATAAGATAAATCTGGATTTTAAAATCCAATAAGGATAAAATACTTTAAAAAAATTATGAAATCAGATTAAAACAAATGAATTCATGCAAAATTTCGCCAAAATAATCTTTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5481
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 None None 230 None 6
ENSDART00000093090 Nonsense 574 793 13 17
ENSDART00000121932 None None 334 None 9
ENSDART00000143554 Nonsense 537 756 14 18
Genomic Location (Zv9):
Chromosome 8 (position 26136295)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25264213
GRCz11 8 25283352
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAAAACCTGTCAACTGGACGGATGAAGACAATCCTCCATACTCKTATTA[T/A]CTGTACTACATGTATGCAAATATGACTGTACTCAACCACCTGCGCAGGTA
Long Flanking Sequence:
TTTTCCATCAGTCTTAGTACACAATCTAACTACAGTCAAGCTTTAAATGGGAAAACATTTTTGAAAATTTGATGGAGATGCTAATGGTCTAATCCAATTCAATTATGCATGCTAAGCTAAGCTAAAAGTGCTACAGCCAGACCTGGAGATCAACAGAATGGATTCATAAAATGTTAAACTGTTAATCTTTAAGGAAGTTGTGAGATGAGCCTATTTTCAAAAACAGTGGAGTGTTTCTTTAAGATAAGAAAATACCTGTAATTAAACTTTACCCTTAGTAGTGAAATCACGAGATCCCACTTCACTAACCAAAATAAAATCATAACCAGTCACACACCCAGAGTAAGTATGCTCAAAGTGTCATTATATTATGTTGCTCTTTAGGTTGTTGGGTTTGACAGTGTGGATGATGAGTCCAAACCTGAGCATCACATCTTTAACCTGGACAGTCCAAAACCTGTCAACTGGACGGATGAAGACAATCCTCCATACTCTTATTA[T/A]CTGTACTACATGTATGCAAATATGACTGTACTCAACCACCTGCGCAGGTATTTAATCCACGCTTTGCATATTTCACATTGATTTGAGACTAAGATTTTGGGACATAAACAGCTAAACTTAAATTTAAAAAAATGGGTTAAAGGGATAGTTCACGCAAGATTGAAAATTCCTTCATTATTTATTACATCTCTCCCTCAAGTGGTTACAAACATGTTTGAGTTTACCTTCTTTGGTTGAAAACAAAACAAAAAAAACATACTTTGAAAAATGCTGGAAACTGGCCATTTTTTCCACTTATGAAATTCAATGGCTGAACAGAAGAAACAAAGTCATAAAAGTTTAGATCACTTGAGGATGAGTAAACTGCATTATTTATGTCTCTCAACAGGCAAAGAAACATGAATTCGTTCGTGTTACGTCCTCACTGTGGAGAAGCAGGGCCGATTCACCACCTTGTGTCTGGATTCATGCTGTCAGAGAACATTTCCCATGGCCTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10749
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 None None 230 None 6
ENSDART00000093090 Essential Splice Site 590 793 14 17
ENSDART00000121932 None None 334 None 9
ENSDART00000143554 Essential Splice Site 553 756 15 18
Genomic Location (Zv9):
Chromosome 8 (position 26136682)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25264600
GRCz11 8 25283739
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTTTAGATMACTTGAGGATGAGTAAACTGCATTATTTATGTCTCTCAAC[A/T]GGCAAAGAAACATGAATTCGTTCGTGTTRCGYCCTCACTGTGGAGAAGCA
Long Flanking Sequence:
GTTGGGTTTGACAGTGTGGATGATGAGTCCAAACCTGAGCATCACATCTTTAACCTGGACAGTCCAAAACCTGTCAACTGGACGGATGAAGACAATCCTCCATACTCTTATTATCTGTACTACATGTATGCAAATATGACTGTACTCAACCACCTGCGCAGGTATTTAATCCACGCTTTGCATATTTCACATTGATTTGAGACTAAGATTTTGGGACATAAACAGCTAAACTTAAATTTAAAAAAATGGGTTAAAGGGATAGTTCACGCAAGATTGAAAATTCCTTCATTATTTATTACATCTCTCCCTCAAGTGGTTACAAACATGTTTGAGTTTACCTTCTTTGGTTGAAAACAAAACAAAAAAAACATACTTTGAAAAATGCTGGAAACTGGCCATTTTTTCCACTTATGAAATTCAATGGCTGAACAGAAGAAACAAAGTCATAAAAGTTTAGATCACTTGAGGATGAGTAAACTGCATTATTTATGTCTCTCAAC[A/T]GGCAAAGAAACATGAATTCGTTCGTGTTACGTCCTCACTGTGGAGAAGCAGGGCCGATTCACCACCTTGTGTCTGGATTCATGCTGTCAGAGAACATTTCCCATGGCCTACTTCTCAGAAAAGTAAAGACACTCTTGATACTTTTACTGGCTCACGGTCACCTCAGAAATCTGTTCTGCACAGATTTAAAGCATGCTATGTGTATTTATTTATTTTTTTACATGTCATTTTTTTGTGTTAGACCAAGGCCACATCGCACTTTTGAGCAGTGTCACACACTTCATTTTCTCCATCAAACACCTTCAACTTAGATTTTTCAGTCAGTCCTTGAAAGCAATATCAGATCAATCTGTGTCCCAGTTTAGAAGATCTTGTTATGTGTAACATTTTTTGAAAATTAAAAAAGAGACTGCTTAGATTGTGTTTCTGTACTGGTTTAGGCCGGTCATGGATAGAAATCCATTTCTAGTACAGTTGATTTAATTTTAAAGATTGCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa872
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 None None 230 None 6
ENSDART00000093090 Nonsense 636 793 15 17
ENSDART00000121932 None None 334 None 9
ENSDART00000143554 Nonsense 599 756 16 18
Genomic Location (Zv9):
Chromosome 8 (position 26141845)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25269763
GRCz11 8 25288902
KASP Assay ID:
554-0774.1 (used for ordering genotyping assays)
KASP Sequence:
CTGTTGAGTGATATGTTGCTGTATTTCCCACAGGCTCCTGTACTGCAGTA[T/A]CTGTATTATCTGGCTCAGATTGGCATTGCTATGTCGCCGCTCAGCAACAA
Long Flanking Sequence:
CCTAATGTTTTAGATCAGGGTGTCCGCAGAGTCTTAAAAAGTACTTAAATGTCTTACATTTTAAGCCTTAAAAAGTCTTACATTCACTGAAATATTGTGTTGTAGGTTTTAAATAATTTTAAACAGGTCTTAATTTACGTCAAGGGTCAACTACCTGATCAGGCTGACACAAAACACAACTTTTTTTTATATTTAAGTCTTTTATTGCAAAGAAATGCAATTCAAAACAGCTATTAAGACATTTAAAGGAAATTCTCCTAATTAAATTCCCCAATCGGGAAAAGAAAACTAAAGAAACAGATCCCTTTACAAAAAAAATACTAAAACTTTTTACGGATGTAACTGGGCCATTAGAAAATATCCTTAATGTTTAGCCCTGTATAAGTCTAAAATTTCATTCATAATGATCTTAAAAAGTCTTAAATTGACTTGAAGAAACCTGCAGAAATCCTGTTGAGTGATATGTTGCTGTATTTCCCACAGGCTCCTGTACTGCAGTA[T/A]CTGTATTATCTGGCTCAGATTGGCATTGCTATGTCGCCGCTCAGCAACAACAGCCTCTTCCTCAGCTACCATCGAAATCCACTGCCTGAATATCTGTCCAGAGGCCTCATGGTGTCTTTGTCCACTGACGACCCTCTGCAGTTCCACTTCACAAAGGTTAGAAGTCAAACCACATCATCTGATATGAAGTGTTTTTACTTATTGTGTGGATAAATGTGTTTGACCGAATATATGTGTGGTTTGTTTAGGAGCCACTGATGGAGGAGTACAGCATCGCCGCTCAGGTGTGGAAGCTGAGCTCATGTGACATGTGTGAACTGGCCCGAAACAGTGTGCTCATGAGCGGATTTTCAAACCAGGTGCTCACAGCTACACTTACACTTCTATTCAAGCACTTTTGGTTCTTTTTTGTGACATTTGACAGTAAGTTAATGCATCAGTTAATGTATTTTAAAGCATAATCTAACAAAAAGCCTAAAATGTTATAGTAATGTAGCTTT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3684
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 None None 230 None 6
ENSDART00000093090 Nonsense 638 793 15 17
ENSDART00000121932 None None 334 None 9
ENSDART00000143554 Nonsense 601 756 16 18
Genomic Location (Zv9):
Chromosome 8 (position 26141851)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25269769
GRCz11 8 25288908
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGATATGTTGCTGTATTTCCCACAGGCTCCTGTACTGCAGTAWCTGTA[T/A]TATCTGGCTCAGATTGGCATTGCTATGTCGCCGCTCAGCAACAACAGYCT
Long Flanking Sequence:
GTTTTAGATCAGGGTGTCCGCAGAGTCTTAAAAAGTACTTAAATGTCTTACATTTTAAGCCTTAAAAAGTCTTACATTCACTGAAATATTGTGTTGTAGGTTTTAAATAATTTTAAACAGGTCTTAATTTACGTCAAGGGTCAACTACCTGATCAGGCTGACACAAAACACAACTTTTTTTTATATTTAAGTCTTTTATTGCAAAGAAATGCAATTCAAAACAGCTATTAAGACATTTAAAGGAAATTCTCCTAATTAAATTCCCCAATCGGGAAAAGAAAACTAAAGAAACAGATCCCTTTACAAAAAAAATACTAAAACTTTTTACGGATGTAACTGGGCCATTAGAAAATATCCTTAATGTTTAGCCCTGTATAAGTCTAAAATTTCATTCATAATGATCTTAAAAAGTCTTAAATTGACTTGAAGAAACCTGCAGAAATCCTGTTGAGTGATATGTTGCTGTATTTCCCACAGGCTCCTGTACTGCAGTATCTGTA[T/A]TATCTGGCTCAGATTGGCATTGCTATGTCGCCGCTCAGCAACAACAGCCTCTTCCTCAGCTACCATCGAAATCCACTGCCTGAATATCTGTCCAGAGGCCTCATGGTGTCTTTGTCCACTGACGACCCTCTGCAGTTCCACTTCACAAAGGTTAGAAGTCAAACCACATCATCTGATATGAAGTGTTTTTACTTATTGTGTGGATAAATGTGTTTGACCGAATATATGTGTGGTTTGTTTAGGAGCCACTGATGGAGGAGTACAGCATCGCCGCTCAGGTGTGGAAGCTGAGCTCATGTGACATGTGTGAACTGGCCCGAAACAGTGTGCTCATGAGCGGATTTTCAAACCAGGTGCTCACAGCTACACTTACACTTCTATTCAAGCACTTTTGGTTCTTTTTTGTGACATTTGACAGTAAGTTAATGCATCAGTTAATGTATTTTAAAGCATAATCTAACAAAAAGCCTAAAATGTTATAGTAATGTAGCTTTTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7613
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045798 None None 230 None 6
ENSDART00000093090 Missense 730 793 17 17
ENSDART00000121932 None None 334 None 9
ENSDART00000143554 Missense 693 756 18 18
Genomic Location (Zv9):
Chromosome 8 (position 26144192)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25272110
GRCz11 8 25291249
KASP Assay ID:
554-4216.1 (used for ordering genotyping assays)
KASP Sequence:
GCGCATTTATCTGACCTATTCAAATGTCTTCTGTGAAGGTGAAAAGCTAC[T/C]GGTTGGGGCCGCATTAYATAAAAGAGGGACAAGAGGGCAATGACAWCMGA
Long Flanking Sequence:
TCTCCCTCTACTTATTATGTGGTTTCTGTCGCCATTTTGTGGCAGAACGTCGATCACCACTGTCGACCGATGCACCGAATCTCCGAAATGATATTTTAAAATAGGCACTATCCTTATAAATAAACTGCATAGTTGCGATCTAAACTATTATATTCTCAACTAAAAAAGCCTTAAAAGTACATTATGTTGTATAACTGCAGCAAAATTTATTAAACTGTAGAGTGTCCTTTGCTTGTCGCTGTATGTGGGCAAAGTAATACACAAGGGTGATAAGGCTGTACGAATACTGGCCTTTAAAGAATATCACTTGATTATCAGCCAAGAACAAGACAGAACTGTTTTTAATATAAATCTATATATATTTCTGAATTATTGGCTGCCATTCAATTTTAGCACTGTATTTAGCCACCACTGTTGACACAGATGATTTAAATACAATCTACCAGAGACGCGCATTTATCTGACCTATTCAAATGTCTTCTGTGAAGGTGAAAAGCTAC[T/C]GGTTGGGGCCGCATTATATAAAAGAGGGACAAGAGGGCAATGACATCAGACGTACCAACGTTCCTGATATCCGTGTGGCGTATCGCTTCGAGACTCTGTGTGAAGAACTGAATCTGATCACACAGGCAGTGCGGTCAGAGGAGCTGGAGACGGTCAAAGAGGAGGGATCCCTGTGCATGGCTTCAATACGCTAACAGTGTTTCACACTTTCAATTATTCAACCAGTGCAGAGTGTGAGTAAAAGGTTAATCAGGGAAATGTGGGACTGACTTTCTGTCCACAGGTATTCACCTAAACCCAATTGATAGTAATGTTTTGTAATTCATTTGGAAGCATTGTGCAGTTTTAAAGGGATGGTTCAGTCATAAATGAGAATGTGCTAATTTACTCACTCTCAGGTTACGGAAGATGTAGGTGACTTTTTCTTGAAAGTTTTTAGCTGAAACTGTGGTCGTTGGTGATTCACATAAAGTAGTTTAACAGTTACCAGCAATTTAATG
Associated Phenotype:
Not determined