Busch Lab

ZMP

atp13a

Ensembl ID:
ENSDARG00000029931
ZFIN ID:
ZDB-GENE-040426-2804
Description:
probable cation-transporting ATPase 13A1 [Source:RefSeq peptide;Acc:NP_001001403]
Human Orthologue:
ATP13A1
Human Description:
ATPase type 13A1 [Source:HGNC Symbol;Acc:24215]
Mouse Orthologue:
Atp13a1
Mouse Description:
ATPase type 13A1 Gene [Source:MGI Symbol;Acc:MGI:2180801]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa20141 Essential Splice Site Available for shipment Available now
sa13862 Essential Splice Site Available for shipment Available now
sa31360 Nonsense Available for shipment Available now
sa20142 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20141
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042147 Essential Splice Site 373 887 6 18
ENSDART00000058958 Essential Splice Site 392 1242 6 25
Genomic Location (Zv9):
Chromosome 3 (position 53551441)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52658756
GRCz11 3 52913419
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATTGTGGATGAAGCCATGCTTACAGGAGAGTCTGTGCCGCAGATGAAG[G/A]TGCGTCTGCTTGCTTTTTCCACTTCAAACTATTATACCATCAGCTTTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13862
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042147 Essential Splice Site 373 887 6 18
ENSDART00000058958 Essential Splice Site 392 1242 6 25
Genomic Location (Zv9):
Chromosome 3 (position 53551442)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52658757
GRCz11 3 52913420
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATTGTGGATGAAGCCATGCTYACAGGAGAGTCTGTGCCGCAGATGAARG[T/A]GCGTCTGCTBGCTTTTWCCACTTCHAWCTAYTATACCATCAGCTYTCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31360
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042147 Nonsense 439 887 9 18
ENSDART00000058958 Nonsense 458 1242 9 25
Genomic Location (Zv9):
Chromosome 3 (position 53555991)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52663306
GRCz11 3 52917969
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATTATTAACATCTTAAACTTTGCTGTGTCTATATTTAGGGCAAATTAT[T/A]GAGAACGATTCTGTTTGGTGTGAAAAGGGTAACGGCCAACAACCTGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20142
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042147 Essential Splice Site 616 887 12 18
ENSDART00000058958 Essential Splice Site 635 1242 12 25
Genomic Location (Zv9):
Chromosome 3 (position 53561834)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52669149
GRCz11 3 52923812
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCCTGGAGAAGGCTATGCTGACCGCAGCAGACTGGACGCTCACTAAAG[G/A]TCTGATTAATACACTGCACAAGACAAAGGCTGAGCCACACACCATCATCT
Associated Phenotype:
Not determined