Busch Lab

ZMP

si:ch211-257p7.1

Ensembl ID:
ENSDARG00000029925
ZFIN IDs:
ZDB-GENE-050222-3, ZDB-GENE-091204-73
Description:
Discs large homolog 1-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q5PYH5]
Human Orthologue:
DLG1
Human Description:
discs, large homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:2900]
Mouse Orthologue:
Dlg1
Mouse Description:
discs, large homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:107231]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa1431 Nonsense Available for shipment Available now
sa10085 Nonsense Available for shipment Available now
sa15931 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1431
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043795 Nonsense 62 827 2 22
ENSDART00000061429 Nonsense 133 906 4 25
ENSDART00000134260 None None 192 None 4
Genomic Location (Zv9):
Chromosome 2 (position 4883452)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5154388
GRCz11 2 4995053
KASP Assay ID:
554-1359.1 (used for ordering genotyping assays)
KASP Sequence:
CTCCACAGGAGCCGAGTTCRCCACAGTTCACCGATGATACTCCTGGGCCT[G/T]AGCTGGTGCAAGTGGCTGAGAAGAGCCTCYCCCAGATTGAAAATGTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10085
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043795 Nonsense 231 827 7 22
ENSDART00000061429 Nonsense 296 906 9 25
ENSDART00000134260 None None 192 None 4
Genomic Location (Zv9):
Chromosome 2 (position 4837572)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5108156
GRCz11 2 4948821
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAACGAGGTGGACGTCAGAGAYGTCACCCACAGTAAGGCYGTGGAGGCKT[T/A]GAAGGAGGCAGGCTCSCTGGTCAGACTGTATGTCAGGAGGAGAAAATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15931
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043795 Nonsense 569 827 14 22
ENSDART00000061429 Nonsense 634 906 16 25
ENSDART00000134260 None None 192 None 4
Genomic Location (Zv9):
Chromosome 2 (position 4813780)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5084363
GRCz11 2 4925028
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGTCAACGCTTCAGATGACGAGTGGTGGCAGGCCAGACAGGTCACAGCT[C/T]AAGGAGAGGTGGAGGAGATGGGGGTTATCCCCAGCAAGAGGAGGTGAGGG
Associated Phenotype:
Not determined