Busch Lab

ZMP

zgc:63637

Ensembl ID:
ENSDARG00000029885
ZFIN ID:
ZDB-GENE-040426-2686
Description:
ras-related protein Rab-6A [Source:RefSeq peptide;Acc:NP_998530]
Human Orthologues:
RAB6A, RAB6B, RAB6C
Human Descriptions:
RAB6A, member RAS oncogene family [Source:HGNC Symbol;Acc:9786]
RAB6B, member RAS oncogene family [Source:HGNC Symbol;Acc:14902]
RAB6C, member RAS oncogene family [Source:HGNC Symbol;Acc:16525]
Mouse Orthologues:
Rab6, Rab6b
Mouse Descriptions:
RAB6, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:894313]
RAB6B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:107283]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa2741 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa2741
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045555 Essential Splice Site 46 211 2 8
ENSDART00000075056 Essential Splice Site 46 211 2 8
ENSDART00000131140 Essential Splice Site 46 211 2 9
ENSDART00000138294 Essential Splice Site 46 211 2 8
Genomic Location (Zv9):
Chromosome 14 (position 34271094)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32955794
GRCz11 14 33296108
KASP Assay ID:
554-2641.1 (used for ordering genotyping assays)
KASP Sequence:
TTCACTTATCACCAGGTTTATGTATGACAGCTTTGATAATACTTATCAGG[T/G]AACTATCACATCCCATTTTATATTTATTATTATTTTATCTGTCTTAWGTA
Long Flanking Sequence:
GCTGTCTTGTGTGAAGATGGTTGCTAGCTGTTAGCGGTTAGCATGCTTCTAGCTAGCCGGTTGTGACAATCAAGATCATGAGATCATAAACCACATCAGGGATGTTTAACTGCCACATCATCAGCGTCACATTCACGCATACGTTTATAATGGCTGGATTTGATGTCTGAAATATCACTAGTGAGCTGTCTTAACGAGAGTTTTTGCATGTCTTGGATGTGGTTATGTTGCTGTGAAAGCAGGACGGCGACACCCATGTTGCCAACACGGCGAACAGAGTTCAGACTCATCCTGCAGACCCATTCATCCCTTCCCTTTCCCACAGCTTCATAAGTTTGACGTGAAACCATGCTGTCTTTGAAGGCAACTCGCAAGATTTTGAGACGCATCTCCTGTAAGGCCCTTGGTTCTAATGTTTTGTCTTGTCTTTTCTTCCACAGTGGGCAAAACTTCACTTATCACCAGGTTTATGTATGACAGCTTTGATAATACTTATCAGG[T/G]AACTATCACATCCCATTTTATATTTATTATTATTTTATCTGTCTTATGTAAAAGATGCTTACCATGTTATCTGCTCAAATGCTTTTTTCTTAAAAGTGAACATTTTGCAGTTAATCGACTCATTATCTGTTTAATTGTAAGATTTAAATGCTGCATTTTAAAGCATTTTTTGCACTATTATTTGCTGGATTAGCTTGTTGGATGGTCATCATAATTACTCTTCTTGATGTACTAAAATATGTCCTAAAGATTTTGAGCTTAGGTGTCAAACTCAGTTTCTGGAGGGCCGCAGCTCTGCTCAGTTTTGCTCCAACCCTATTCAAATACAGCTGATCCAACTAATAAAGTTGTCCAAGAGTAATCTTGAACACCTTAATTAGTTGGATAAACTGTTTGATTAGGATTGGAGGAGTTCTTTGCAGAGCTGCGGCCCTCCAGGATTTGAGTTTGAGACCTATGATTTGGAGCAGGGGTAGGGAACCTATGGCTCGGGATCCACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28334
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045555 Nonsense 164 211 6 8
ENSDART00000075056 Nonsense 164 211 6 8
ENSDART00000131140 Nonsense 164 211 6 9
ENSDART00000138294 None None 211 None 8
Genomic Location (Zv9):
Chromosome 14 (position 34263060)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32947760
GRCz11 14 33288074
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCGGGAACTGGGGGTGATGTACATAGAGACCAGCGCCAAAGCTGGCTA[T/G]AACGTCAAACAGGTGGGTGACACCATACAGCTGTAGTGTAGGCCAAAGTT
Long Flanking Sequence:
CAGTTTGAGCAGATCACAAGACTTTTAGCGAGTCCATATAACGTTTTCCCCTTTTGTTTCTTCAGATCTTAACTCTTTCCAGCAAACCTCAAAGTGGATAGATGATGTCAGAACAGAGAGAGGAAGTGATGTTATTATCATGTTGGTTGGCAACAAGACAGACCTGGGTGATAAAAGGTAAACAAATCAGAGAAGACTGATGAAGCTTTTTGTTTGTCTCCCAGACATCTCACTTTTAAGTTGTTTTATTCCGTTTTCTCGTTATCATTATTTTAAGTGTTATGTTGATTAATTTGTTTCTGTTCAGTCATAGTTTCTCTTGTGTTGATTTTTATTTTTGATTTGCCATTACTCCCTTTTGTTTTTCATATTCATTCTAATTTGCACTGTTTCCACACCTGCACTATGGACTATGGCAGGCAAGTGTCAGTAGAGGCAGCAGAGAAAAAAGCTCGGGAACTGGGGGTGATGTACATAGAGACCAGCGCCAAAGCTGGCTA[T/G]AACGTCAAACAGGTGGGTGACACCATACAGCTGTAGTGTAGGCCAAAGTTTTCTCATTTCTACAACACAATCTGTGGCATGATGACCAATGTCCACCGAAAATTCATTTGGACTCTGTATTTAAATGGTAAAAACAAGCAAAACACAATTACAGCAGCAAGATTATAGTGAATACCTGTCAAGCAAACATGCATCACCTTTAATAAATGCTTTCAACAGGGTATTACTGTATTTTCAAAATATAACTCTGAAGCAGGGGTATCAAACTCAGTTCCTGGAGGGACCCAGCCCTGCACAGTTAAGCTCCAATCCTACTTCAATACACTTACCTAGAGGTTTAAAACAAACTTGAAAGACTCAGTAAGTTTGAGCTTGTGTGGGGATCTAACTAATCTGTGCAGAGCTGCGGCCCTCAAGGAACTGAGTTTGACACCTGTGCCCTGAAGTCATATTTTGACAAAACTTTGCAATGTTTGGAGCACAAATTATTACACAGCAGG
Associated Phenotype:
Not determined