Busch Lab

ZMP

rufy3

Ensembl ID:
ENSDARG00000029692
ZFIN ID:
ZDB-GENE-050327-58
Description:
protein RUFY3 [Source:RefSeq peptide;Acc:NP_001014357]
Human Orthologue:
RUFY3
Human Description:
RUN and FYVE domain containing 3 [Source:HGNC Symbol;Acc:30285]
Mouse Orthologue:
Rufy3
Mouse Description:
RUN and FYVE domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:106484]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa45222 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40532 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45222
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039973 Essential Splice Site 358 470 10 13
ENSDART00000125364 Essential Splice Site 299 570 9 17
Genomic Location (Zv9):
Chromosome 5 (position 44549658)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 42330923
GRCz11 5 42931076
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTGGAGAAACTCGCAAACAGCTCAAAGAGGAAACTCAGCTCAGACTTG[T/A]AAGTAAAACATTAATGTAAAGCAAAGTAGAGTAAGACACCATGTTAGAAG
Long Flanking Sequence:
TAAAATTGCTCGATTCTCAGGATTTGAACATTCTATGAGACATTTGGGATAATGTAAACACATATGTTATCCAAGTATATAAGATCGTATTAGTCCTTTTTATATATTTTTATAAAACAGTCATACATATTGTGGTCTTTATGTAGGTAGATAATAGCTGTTAGTAGGCAATAATTCATTTGTTAACTCAACTATGTGTGCACATTCTGTTTCTTGTTTAGCTTGCTGTTGCAAACAACAGGATCATCACTCTGCAGGAAGAACTGGAAAGAGTAAAGGAAGAGGGCTCTTACTTTGTGGAATCCAGTCGCAAGGTGAGCAAACACTGTGTTGAACTCACAACTATATAATTCAAATCACAGATGGCTAACAATCAGTCCAACAACATGATTTATGACCTGTGTTCCTCCTGAAGGCTTCGAGGGCAGATGGAACTGCAAATGGCCAAGTGCTTGGAGAAACTCGCAAACAGCTCAAAGAGGAAACTCAGCTCAGACTTG[T/A]AAGTAAAACATTAATGTAAAGCAAAGTAGAGTAAGACACCATGTTAGAAGTGCATGATTGTGATTTGTGTGTGTGCAGGATGTGGAGAAGGAGCTGGAGCTGCAGATCGGGATGAAGCAGGAGATGGAGTTGTCCATGAAGATGCTAGAGAAGGACATCTGTGAGAAACACGATGCTTTGGTGGAGCTCAGACAGCAGTTAGATGACGTGCGCACACTCAATCATGAGCTCTCCGTTAAGTCACAGGTAGGAAAAACACACTTACAGGTTTCTCACATGAAAGTTTTACAGAGGAGCGGCTTCTCAAGCTTCAACACTTTTTTTTATACATACAATATATTGAGTCGGGACTATAGTTGAGCAGGAGCCATAGTTGAAAACATGATTTATGGGGTCTTGGCCATACGTTTACTAAAAAGTTAATCATTTGCATGGGTCATTTGCATATTTTTTCTGTGTGCATTTCAGGTCAGTTTAAAGCATTCAGACACTAGAAAAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26549
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039973 None None 470 None 13
ENSDART00000125364 Nonsense 394 570 12 17
Genomic Location (Zv9):
Chromosome 5 (position 44553470)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 42334735
GRCz11 5 42934888
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCACCTCATTAAGTTAATGTGGCCCAAATTCAGATGTAAGAAGGCGGAG[C/T]GAGAGCGGGATCTGGCGGACGAGGCCAATCGACTCTTCAAGCAGGAGTTT
Long Flanking Sequence:
AAGCAAAGCAACCAAGTTTCTTTCTCTCTGGCATATTCAAGAGTTTATTTGTGGATGTTGAGTGCAGAAATGTTTGCTTGGATTATTTTACAGCTGGCAAACGTCATAAAATCTGAATTTGATGCCGTGGTAGATGATGCTAAAACTCAAAAGCTTTGGAAAGATGTTTGTGTCCCCGAGCTTCTGCGGAAAGGATGCTAAAATCCTCTAAATTGTGAACGAACTGACATTGTATGTAGACCATAATATAGATGTGAACTGTAGCAAAACATAGCTTAATAAAAAACCAATCAGACACTTGTCAGACTGATTTGCTTTCTTGAGCACCTCCAGTTTTCGTTTGTTTCCTCCTGTCTTCTCCAGCTTGTCTTTTGAGTTCATCCTTCATGTCTTCTTGGTGCTTTTTCTTATTTAATTCGTCTTCGTTTTTCCATGGCTTTTAGTTTTCATTTCACCTCATTAAGTTAATGTGGCCCAAATTCAGATGTAAGAAGGCGGAG[C/T]GAGAGCGGGATCTGGCGGACGAGGCCAATCGACTCTTCAAGCAGGAGTTTGGGGACAAGATTGAGAGTCTGCAGACGGAGGTGGAGCAGCTGCGGAGACAGAGGTGCTGAGATTTACTCACTGAACTTTTTGTTACTAATACTGGTCAGTGGACATGCCGTTTATTAAGCTTTACAAAACAAACAAGTATAGTAACATCAGATAATATGTTAAGCATCGAATTGACATGTATGAAAAATTATAATATTTTAAAGCACTTGTTAATCCAGGATAACTTCTTGTACACATACTATACAAGACTTCTACTGTGTACATGTTTTAGGGTCAATGTCATGTTTTAAATGGCTCCAGTTGTGCATTATAAAAGATTTTGGTTTTGGGGGTCTTATGTTTTGGTTTTAGGGACACTTTCCTTGTCTTATAATATGCATTTTAGGGTTGGGTCGATGGCCATCGCTGATTGCTGATAGACATCACGATGCTAAGCCGGCATTGCGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40532
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039973 None None 470 None 13
ENSDART00000125364 Nonsense 463 570 13 17
Genomic Location (Zv9):
Chromosome 5 (position 44556453)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 42337718
GRCz11 5 42937871
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCTGAAACTCTGCTGGGAAAAACACCTCCGCAGCAGAGAGACAGCAAA[C/T]AACACATCGAGGACATCAGAAAGGTGAAGCTCTTTCAAATTTCACTGAAT
Long Flanking Sequence:
TATCTTGTTTTTCTACTGTGGAAGTCAGCTTTCTTCAAAATATCTTAATTAATATTAATTTATGGTAGGATGCGTTCACACTTGGTCCTACCCTGTACAGATACTTTCCAATAAAAGTGAACCAAATAAGATAAATTGTGTCTATGTGAACCAATTGTGAAGTGAACATTTTCTATTTTAGTTTTCTTATTGCAAGTGGCATGAACATAAATAGAAAAATAAACAAGCAAACATAAACAGGAATGTAAAATGTGTGGCTGATATTTACGCCAGTCTCCTGAACCCTATACTTAAAGCACACATGTGGTCATTATCGGGTATTTTTCGGCCACTGCTACTGTGTAAAATGCAGACATGTGCTTGTGAAAGTGAAAGAGTCTTTCTCTCTGTGTGATAGGTGGATTTTGGAACAAGAGCTGAAGAAAGGCAGAGATCATCCTGGAGTCCAAACACCTGAAACTCTGCTGGGAAAAACACCTCCGCAGCAGAGAGACAGCAAA[C/T]AACACATCGAGGACATCAGAAAGGTGAAGCTCTTTCAAATTTCACTGAATTCACTGAATTTTCACATTAAGATACTTTCTCTGCATAAGTGTAGTTTTCTGAAATGCATACGTTTTTATATAGGAGTTAGAGTCTGTCAAAAAGGAAAATGATACACTGCGCACTGCACTAGAGGAAAAGACGAGTCTGAGTTCCAGTTTGTAAGTTTATCTTAAACACTGAAACCTTTGTGTTAAGCTGTATTAATGAACTGCAGTGTTATTGAAATAATCTTAAAACTGTTTTTCTTAGGACACTGTCACATGAAGATGAACAGGTACGCTACATTTTATTAATCTGTGAGGTTTGCTCCAGTATTCTTATTGTTCTTTTCATGAATTCATGAAGTTTCCTTTTGTTTGTTAGAACCAGTCTCTTTGTAAAGAGGTTGACCCTTCAATCTGCACAATGTGTGAAAACCAAGACTCACTGACTTCACCCAAGGTACCAGAGTGATCTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8201
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039973 None None 470 None 13
ENSDART00000125364 Essential Splice Site 470 570 13 17
Genomic Location (Zv9):
Chromosome 5 (position 44556477)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 42337742
GRCz11 5 42937895
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACCTCCGCAGCAGAGAGACAGCAAACAACACATCGAGGACATCAGAAAG[G/A]TGAAGCTCTTTCAAATTTCACTGAATTCACTGAATTTTCACATTAAGATA
Long Flanking Sequence:
TCAGCTTTCTTCAAAATATCTTAATTAATATTAATTTATGGTAGGATGCGTTCACACTTGGTCCTACCCTGTACAGATACTTTCCAATAAAAGTGAACCAAATAAGATAAATTGTGTCTATGTGAACCAATTGTGAAGTGAACATTTTCTATTTTAGTTTTCTTATTGCAAGTGGCATGAACATAAATAGAAAAATAAACAAGCAAACATAAACAGGAATGTAAAATGTGTGGCTGATATTTACGCCAGTCTCCTGAACCCTATACTTAAAGCACACATGTGGTCATTATCGGGTATTTTTCGGCCACTGCTACTGTGTAAAATGCAGACATGTGCTTGTGAAAGTGAAAGAGTCTTTCTCTCTGTGTGATAGGTGGATTTTGGAACAAGAGCTGAAGAAAGGCAGAGATCATCCTGGAGTCCAAACACCTGAAACTCTGCTGGGAAAAACACCTCCGCAGCAGAGAGACAGCAAACAACACATCGAGGACATCAGAAAG[G/A]TGAAGCTCTTTCAAATTTCACTGAATTCACTGAATTTTCACATTAAGATACTTTCTCTGCATAAGTGTAGTTTTCTGAAATGCATACGTTTTTATATAGGAGTTAGAGTCTGTCAAAAAGGAAAATGATACACTGCGCACTGCACTAGAGGAAAAGACGAGTCTGAGTTCCAGTTTGTAAGTTTATCTTAAACACTGAAACCTTTGTGTTAAGCTGTATTAATGAACTGCAGTGTTATTGAAATAATCTTAAAACTGTTTTTCTTAGGACACTGTCACATGAAGATGAACAGGTACGCTACATTTTATTAATCTGTGAGGTTTGCTCCAGTATTCTTATTGTTCTTTTCATGAATTCATGAAGTTTCCTTTTGTTTGTTAGAACCAGTCTCTTTGTAAAGAGGTTGACCCTTCAATCTGCACAATGTGTGAAAACCAAGACTCACTGACTTCACCCAAGGTACCAGAGTGATCTAACACTTTTTATTTTTTTGAGAAAGA
Associated Phenotype:
Not determined