Busch Lab

ZMP

si:ch211-255l14.9

Ensembl ID:
ENSDARG00000029590
ZFIN ID:
ZDB-GENE-060503-415
Description:
hypothetical protein LOC569861 [Source:RefSeq peptide;Acc:NP_001116174]
Human Orthologue:
JPH3
Human Description:
junctophilin 3 [Source:HGNC Symbol;Acc:14203]
Mouse Orthologue:
Jph3
Mouse Description:
junctophilin 3 Gene [Source:MGI Symbol;Acc:MGI:1891497]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa12230 Nonsense Available for shipment Available now
sa44251 Nonsense Mutation detected in F1 DNA Not yet available
sa24624 Nonsense Available for shipment Available now
sa38021 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12230
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048614 Nonsense 39 791 1 5
Genomic Location (Zv9):
Chromosome 25 (position 13318395)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 12543822
GRCz11 25 12640327
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGGCCCATGGCCATGGCATCTGCACAGGACCCAAGGGCCAAGGCGAGTA[T/A]GCGGGCTCCTGGAGTCACGGTTTTGAGGTGGTCGGTATCTATACCTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44251
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048614 Nonsense 217 791 2 5
Genomic Location (Zv9):
Chromosome 25 (position 13301896)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 12560321
GRCz11 25 12656826
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGTCCCGCGGAGGCTTCGTTTTGACAGCCCACAGCGAGGCAGAGCTGT[T/A]GAAGAACAAAAAGAAGGGCCTGTTCCGTCGCTCACTCCTAAGTGGTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24624
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048614 Nonsense 602 791 4 5
Genomic Location (Zv9):
Chromosome 25 (position 13269435)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 12592782
GRCz11 25 12689287
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGGAGCGGCACGGGCCAATGGCCACAAGCACTCTTCTAATCATAAGCCT[C/T]GAGACCACAGTTCCTCCAATCACAAAACCCCAAGGGAAAGACGGCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38021
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048614 Nonsense 686 791 4 5
Genomic Location (Zv9):
Chromosome 25 (position 13269182)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 12593035
GRCz11 25 12689540
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGCATGGGGAGGAGCGGCATGGTCACTCAGAGACCCGTGCACATATGT[T/A]ACAGCAACGGGGCAAGAACCGTGATCGGGAGCGGGATGTCCGGGATGCTT
Associated Phenotype:
Not determined