Busch Lab

ZMP

zgc:109953

Ensembl ID:
ENSDARG00000029556
ZFIN ID:
ZDB-GENE-050809-132
Description:
Uncharacterized protein KIAA1310 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q499B3]
Human Orthologue:
KIAA1310
Human Description:
KIAA1310 [Source:HGNC Symbol;Acc:25473]
Mouse Orthologue:
4632411B12Rik
Mouse Description:
RIKEN cDNA 4632411B12 gene Gene [Source:MGI Symbol;Acc:MGI:1918055]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa41304 Nonsense Mutation detected in F1 DNA Not yet available
sa1367 Essential Splice Site F2 line generated Not yet available
sa34509 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41304
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060633 Nonsense 291 835 7 20

The following transcripts of ENSDARG00000029556 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 53608905)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51344264
GRCz11 8 51330793
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTTATTGCTCCATCTGGACCAACCAACCCTGCCTTTCCTACATCCCGA[C/T]GAATGAGATTCTGGCAATCTCAGCTGTCCTGTCTTGGGAAGGTATGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1367
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060633 Essential Splice Site 361 835 9 20

The following transcripts of ENSDARG00000029556 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 53606550)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51341909
GRCz11 8 51328438
KASP Assay ID:
554-1279.1 (used for ordering genotyping assays)
KASP Sequence:
ACCGATCATCTTGGTGGGCTGGAATGTAGGATCATTGATGGCTTGTCATG[T/G]AAGTCTTGCATTAATTAAANNNNATGATTAATTCTTTGATTAGTTGTCTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34509
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060633 Nonsense 665 835 17 20

The following transcripts of ENSDARG00000029556 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 53591201)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51326560
GRCz11 8 51313089
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTGTTTACAGTGGGTTTGTCAGGAAAGCCTCTCGGTCTGACAGTGGGC[C/T]AGACGACAGTATCAGGGGCCAAAGAACTGTCTGAGCTTCTCAGTGCACAA
Associated Phenotype:
Not determined