Busch Lab

ZMP

tfcp2l1

Ensembl ID:
ENSDARG00000029497
ZFIN ID:
ZDB-GENE-040704-58
Description:
transcription factor CP2-like 1 [Source:RefSeq peptide;Acc:NP_001002214]
Human Orthologue:
AC015910.1

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa18247 Essential Splice Site Available for shipment Available now
sa16603 Essential Splice Site Available for shipment Available now
sa8746 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18247
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040480 Essential Splice Site 164 397 5 15
ENSDART00000111960 Essential Splice Site 164 472 5 16
ENSDART00000146663 Essential Splice Site 164 468 5 15

The following transcripts of ENSDARG00000029497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39351460)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38489356
GRCz11 9 38299151
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCGAATTCCTCTGGGATCCTGACAAAAATGCCTCTGTCTTCATKCAGG[T/C]AGAGCTTTTCTTTTATTTCTGAAGTGAGAAACATTAGCGGTAACTTCTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5555
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040480 Essential Splice Site 252 397 7 15
ENSDART00000111960 Essential Splice Site 252 472 7 16
ENSDART00000146663 Essential Splice Site 252 468 7 15

The following transcripts of ENSDARG00000029497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39353218)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38491114
GRCz11 9 38300909
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGATAAAGAAAAATACCAACTGTCCTATAAAACGACTGTGTTGACTGAG[G/A]TAGGAAATCTGATTTGGAAGCATTTTCAGTATTTTTCATAATTATACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16603
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040480 Essential Splice Site 253 397 8 15
ENSDART00000111960 Essential Splice Site 253 472 8 16
ENSDART00000146663 Essential Splice Site 253 468 8 15
ENSDART00000040480 Essential Splice Site 253 397 8 15
ENSDART00000111960 Essential Splice Site 253 472 8 16
ENSDART00000146663 Essential Splice Site 253 468 8 15

The following transcripts of ENSDARG00000029497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39355231)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38493127
GRCz11 9 38302922
KASP Assay ID:
2260-2195.1 (used for ordering genotyping assays)
KASP Sequence:
TTGAGAATAAGGTCAATATTCTTTGTAATAAGKACATTTCTTTTTCTTTY[A/G]GTGCTCCCCTTGGCCCGAAGCCCCATCCATCAGCAGCACGAGCAACACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8746
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040480 Essential Splice Site 253 397 8 15
ENSDART00000111960 Essential Splice Site 253 472 8 16
ENSDART00000146663 Essential Splice Site 253 468 8 15
ENSDART00000040480 Essential Splice Site 253 397 8 15
ENSDART00000111960 Essential Splice Site 253 472 8 16
ENSDART00000146663 Essential Splice Site 253 468 8 15

The following transcripts of ENSDARG00000029497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39355231)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38493127
GRCz11 9 38302922
KASP Assay ID:
2260-2195.1 (used for ordering genotyping assays)
KASP Sequence:
TTGAGAATAAGGTCAATATTCTTTGTAATAAGTACATTTCTTTTTCTTTY[A/G]GTGCTCCCCTTGGCCCGAAGCCCCATCCATCAGCAGCACGAGCAACACTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5556
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040480 Nonsense 287 397 9 15
ENSDART00000111960 Nonsense 287 472 9 16
ENSDART00000146663 Nonsense 287 468 9 15

The following transcripts of ENSDARG00000029497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39355413)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38493309
GRCz11 9 38303104
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAATACATAAACACARTCCCAATTCTGTTTCGTTGCATTTATAGAAACTG[C/A]TCTCCAGACCAGCATGGAGAGCCACTTCTGCCCAGCTGCTCTGATGTAAG
Associated Phenotype:
Not determined