Busch Lab

ZMP

ush2a

Ensembl ID:
ENSDARG00000029482
ZFIN ID:
ZDB-GENE-060503-794
Description:
Novel protein similar to vertebrate Usher syndrome 2A (Autosomal recessive, mild) (USH2A) [Source:Un
Human Orthologue:
USH2A
Human Description:
Usher syndrome 2A (autosomal recessive, mild) [Source:HGNC Symbol;Acc:12601]
Mouse Orthologue:
Ush2a
Mouse Description:
Usher syndrome 2A (autosomal recessive, mild) homolog (human) Gene [Source:MGI Symbol;Acc:MGI:134129

Alleles

There are 26 alleles of this gene:

Allele Name Consequence Status Availability
sa14011 Nonsense Available for shipment Available now
sa16626 Nonsense Available for shipment Available now
sa23107 Essential Splice Site Available for shipment Available now
sa36444 Nonsense Mutation detected in F1 DNA Not yet available
sa23106 Nonsense Available for shipment Available now
sa36443 Nonsense Mutation detected in F1 DNA Not yet available
sa39166 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13155 Nonsense Available for shipment Available now
sa23105 Nonsense Available for shipment Available now
sa11300 Nonsense Available for shipment Available now
sa1881 Nonsense Available for shipment Available now
sa39165 Nonsense Mutation detected in F1 DNA Not yet available
sa13319 Essential Splice Site Available for shipment Available now
sa14237 Nonsense Available for shipment Available now
sa18585 Nonsense Available for shipment Available now
sa23104 Nonsense Available for shipment Available now
sa28877 Nonsense Mutation detected in F1 DNA Not yet available
sa2905 Nonsense F2 line generated Not yet available
sa36442 Nonsense Mutation detected in F1 DNA Not yet available
sa42957 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14514 Essential Splice Site Available for shipment Available now
sa25043 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14011
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 81 5236 1 72
ENSDART00000086201 Nonsense 81 5236 1 72
Genomic Location (Zv9):
Chromosome 17 (position 29830507)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29754434
GRCz11 17 29771397
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCWCACCAGCGAGAGCCACGTGCGGGATTCCCGAAAGGAGTACTTTCTG[T/A]CAAGCTGSCCAGGTTCAGGAAGATCTCCTYACTTGCATCCAGAAGTTCTG
Long Flanking Sequence:
CAAAAGTAATTGTTAAGCTTTTCTTGCATCAACTGGAATTCTTAGAGCCTCAGGGAAGATGTCAGGGTATAATATTTTTCCTAAATAGGTTTTCACAAATGATTTTGCTCTTCCTTTTCTCCTTTGGTTTTCTACAGGACTTTGACGGAGCCCAAATCCTAGCTATCATGTGAAGGCTTTGGCCTCCTCTTTGACATTGTGCCATTAAGCTGCGCTGCCTTACCCAAGGCACTGGACTGTAAAAATGTCACCACCGGCATGACCATCATTACTTATTTAAGATCACTACATCAGGAGGCAACCTCGCCACCAACAACGAATTGGCTCCTTGGGCACAAAGGTGCTATGTTATTACTGTACACCTTGGGCTTTTATGCCTCCCTCAGCCTGGTTGCCCCTCAGGGCAACTTCCCCAGGCTCGAGAACATAGGGGCACATAAATCTGTCAGCACCACACCAGCGAGAGCCACGTGCGGGATTCCCGAAAGGAGTACTTTCTG[T/A]CAAGCTGGCCAGGTTCAGGAAGATCTCCTCACTTGCATCCAGAAGTTCTGCATCCAAGAGTGTCCTCGCAGGCCTTCTACACCCGAATACATTGATGTTCTCACCGTAAACGTGGCCACGTGCTGGAAGGGCGATGCACGGGACCTTCGGCCAGGCGCAGAGGCCAATTCCAGCAGCTTCGTCTTTCCCACTTCAAAAGGTTGTCCGGCTTCCCCCTCGACTCTAGGCTACAGCCCAGCGAGCTCATTTACTTTAACGGTGTGGCTGAAACTCGAGCAAGACACTGTAATGTAAGTAGACACACGTCCAGAATTTTCCCTTAAGAAGATCAGAGAGGTAGTGCAAGTGTTTCTGTCACTTAGAGAGTGAATATTTTACTTAATCAACGGGATCAGTTTCAATACCTGCTCAGTTCCAGGAAAAGAATGACTTGTTAGAGCAACTAAAGTTGTATTATCTAAACCCGATATGGATTAGCTCAGCCGCTCGCCTTGTCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16626
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 81 5236 1 72
ENSDART00000086201 Nonsense 81 5236 1 72
Genomic Location (Zv9):
Chromosome 17 (position 29830507)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29754434
GRCz11 17 29771397
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCWCACCAGCGAGAGCSACGTGCGGGATTCCCGAAAGGAGTACTTTCTG[T/A]CAAGCTGSCCAGGTTCAGGAAGATCTCCTYACTTGCATCCAGAAGTTCTG
Long Flanking Sequence:
CAAAAGTAATTGTTAAGCTTTTCTTGCATCAACTGGAATTCTTAGAGCCTCAGGGAAGATGTCAGGGTATAATATTTTTCCTAAATAGGTTTTCACAAATGATTTTGCTCTTCCTTTTCTCCTTTGGTTTTCTACAGGACTTTGACGGAGCCCAAATCCTAGCTATCATGTGAAGGCTTTGGCCTCCTCTTTGACATTGTGCCATTAAGCTGCGCTGCCTTACCCAAGGCACTGGACTGTAAAAATGTCACCACCGGCATGACCATCATTACTTATTTAAGATCACTACATCAGGAGGCAACCTCGCCACCAACAACGAATTGGCTCCTTGGGCACAAAGGTGCTATGTTATTACTGTACACCTTGGGCTTTTATGCCTCCCTCAGCCTGGTTGCCCCTCAGGGCAACTTCCCCAGGCTCGAGAACATAGGGGCACATAAATCTGTCAGCACCACACCAGCGAGAGCCACGTGCGGGATTCCCGAAAGGAGTACTTTCTG[T/A]CAAGCTGGCCAGGTTCAGGAAGATCTCCTCACTTGCATCCAGAAGTTCTGCATCCAAGAGTGTCCTCGCAGGCCTTCTACACCCGAATACATTGATGTTCTCACCGTAAACGTGGCCACGTGCTGGAAGGGCGATGCACGGGACCTTCGGCCAGGCGCAGAGGCCAATTCCAGCAGCTTCGTCTTTCCCACTTCAAAAGGTTGTCCGGCTTCCCCCTCGACTCTAGGCTACAGCCCAGCGAGCTCATTTACTTTAACGGTGTGGCTGAAACTCGAGCAAGACACTGTAATGTAAGTAGACACACGTCCAGAATTTTCCCTTAAGAAGATCAGAGAGGTAGTGCAAGTGTTTCTGTCACTTAGAGAGTGAATATTTTACTTAATCAACGGGATCAGTTTCAATACCTGCTCAGTTCCAGGAAAAGAATGACTTGTTAGAGCAACTAAAGTTGTATTATCTAAACCCGATATGGATTAGCTCAGCCGCTCGCCTTGTCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23107
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Essential Splice Site 295 5236 4 72
Genomic Location (Zv9):
Chromosome 17 (position 29794992)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29718919
GRCz11 17 29735882
KASP Assay ID:
2261-1203.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGAAGGATGCAGGATTTTAGATTTTATCCGAAGACATTAACCAACAGG[T/C]AAGCATAAGGTCGTACAGCATTAACATCAGGCATAGCTTTAGAGTTTTCA
Long Flanking Sequence:
TTTGCAGAGTTCCTGTAAACCATCAATACCAATGTGTGTGTGTGTGTGTGCATGTGTGAATGATAGGAGCAAAATAAATACAGCAAAATGCTATCTCCTATAAAAGAGAGACTCTGCACACAAAGATGAAAAGATTTCAGGGCAAACATCCATATATGACGTCTCAATCAGAGCCGGTTATTAGAACAGAAGTGATTATATCTTATCTGCTGATGTAGATGGACCCGCACGTTTAGACTCGGATCTATGCCGCCCATCCATTCTGTGGGATTAATGCTCACAGAGAACTGTAAATAAGCATAATAGATCCCACCATGCAGCAAGTGTCTCTTTAACTCAAATAAAGACATAGATAAGGTAATCCACTAGTTGTTATGGATTCTGCACACCGTCTTCAATAGCGCCCATTGACTTTCCTTTCTTTTTTCTCCCCAGGGTCAAATCAATTCATTGGAAGGATGCAGGATTTTAGATTTTATCCGAAGACATTAACCAACAGG[T/C]AAGCATAAGGTCGTACAGCATTAACATCAGGCATAGCTTTAGAGTTTTCAGAGAAAAACATGCTACACTGTAAACAAAACATTAATTTACAGTTGCTGTACCTCATTTCTGTTTATTTGCACTTTAATTGCATTATGAGACCTTGATCTCTGCATCGCTGCAATTACTTTTACTGACATGCTTAGATATTGTTTTATATTATAACATCTAAAATAAAGCAATATAAATAAAATATTAATAATATAATATAAAACAATTGAAAAAGTATATATATGTATGTACACTCACCGGCCACTTTATTAGGTTTACCTGTCTAACTGCTCATTAATGCAAATTTCTAATTACATGGCAGCAACTCAATACATTTAGGCATGTAGACATGGTCAAGACGATCTGCTGCAGTTTAAACCAGACATCAGAATGGGTAAGAAAGATGATTTAAGTGACTTTGAATGCGACATGGTTGTTGATGATAGACGGGCTGGTCTGAGTATTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36444
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 452 5236 6 72
Genomic Location (Zv9):
Chromosome 17 (position 29787082)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29711009
GRCz11 17 29727972
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATGGAGGATAACGGGGCTTTGGATCGTCCTGATTCTGTAAACTGTCTA[C/T]AGTTGCCCAGGTACTGTACACACACTGGCTTTGTATCTCGGTTAGTCCAT
Long Flanking Sequence:
GAGTCCAGCTGTAAAGAAGCAGAGGATTTATGCAGCTCTGCCTCAGTCTCTCCTCTCAATAGCAGATAAAACACACCACCACACAGACTTTGAAGTGTCCACTTAGTCAAAGCTGCAACCAGTTTCTCAACAAACTCCTCCAAATGAAGCCACAGAGGGAGAGAGGGAAGAGTAAAGCGGGTCTTCAAGCTGTTCTTCAAAGCGCCGACGTGCTTTAGGAGGCAGCGGAGCATTGACTGTTGCTGTGCAGATAATAGATAATCCATTGCTGTTTAGTATTTCATGCATATTTCACCCTCTGTCAATTTCGCATGCTTCCTGTACAGGTTTTCTACGTGATACTCCAATTCCTCAATGCTCAGCCCGAAGCGGTCCGCATTCAAAGGAAGACAGTCGGGAGCTCAGAATGGAAAGACTGGCAGTTTCTGGCCAAGAACTGCAGCTACTTTGGCATGGAGGATAACGGGGCTTTGGATCGTCCTGATTCTGTAAACTGTCTA[C/T]AGTTGCCCAGGTACTGTACACACACTGGCTTTGTATCTCGGTTAGTCCATCCACAGCCGCTTCTCACTCTGATAACAGTCCTTGAACAAATGATTCCTGCCAGGTAAGCTGCATCGAAGTGGGTTGAGACAAGTTCCCACTTTGATAAAAGCAGTGGATTGTCATTTAGTGGGAGTCTAGGAGCTTTTGAAGGATCTAGACGGAGAATGGGGAGGAAAATGCTGCTCTTGGCTGCAGTCCAGGCTGCTCAGATCTGATCTCGGCTGTCCTTGGCCGCAGTCAAGACAGCAGAGATACTTAGCTGTTATGGACCACACAAGCACCTGGTTTCACATGCATTCAGCGAAGAAAATGAGGACAGTTATTTTAATGGGTTGGGGCTGAGAGGGTTATCGTAACTGTTTATGATGATAAACTACAGTTCATGTCTCTCTTTTTTTTTGACAGTTCATATTAAGGATGCATAATTGTCCCTAACAAAGTATTAAAGGATGGAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23106
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 730 5236 11 72
Genomic Location (Zv9):
Chromosome 17 (position 29757283)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29681210
GRCz11 17 29698173
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGTGCAGCCAGATATTACCTGTCACCAGGACTCAGGTCAATGCCAGTGC[A/T]AGGCAAACGTAATCGGTACGTATCAAGCAGCATTGCGGCCTCCATCGCTC
Long Flanking Sequence:
TCTTTCTGGCCAGCAGTATTAAATATTTCCTCCCATACATCCAAACACAACAGCTGCTATATTCAACCTCACCCAAAGAAGAGACCCATTCTGTTAAAGCACCCGACCCTCAGCACAAAGGCAGCTTTTGAGCTCAGGTGTTGTGACCCCTCTGCGCCCCCCCATCCCAAACCATTCAGTTCTCTGTAATGGAGATAAAAAGCATCCCAGCGGCCTGCTGGTGGATCAGTATAGAGACAGAGCAGAGCTTGGCCATCCATGACTCCCGCTCAACTTGACTAATTGGAGCGCGGTCACGTGCTGCTCTCTTTCCTCCGCAGATCGGGGGCCAGTGTAAGTGCAAGCGACATGTGTCTGGCAGACAGTGCAATCAGTGCCAACACGGATTCTACAAGCTGCAGTCGGCGCTGGCTGACGGCTGCCGTGCCTGTAACTGCAATACCGCCGGGACCGTGCAGCCAGATATTACCTGTCACCAGGACTCAGGTCAATGCCAGTGC[A/T]AGGCAAACGTAATCGGTACGTATCAAGCAGCATTGCGGCCTCCATCGCTCTTACGCTCTCTGCTCCCATCCTTCTCTTTCTTTACAACTTTTCTTTGCTTGTCTCTCAAGCTTTATTTTTGTTAATTGCCACTAGGGCTGCTCGATAAATCATTTTTTGCAATGTGCAAATCTGCAATATTCACATTGCAGGATCTGCAATGCCAAACTGGGATTATAATTAACCAGAAAACAGTTCAGAACATGCATGGAGAACATGGAGTTGTTGCTAAGTTTATCTTTAATCTAATAATATGAAGTACTTTTATTTGGATGTTTTTTGTTTTTTTTGGTGAATTTAACCCGTTTAGGCACAAGCAATTGTAAAGTTTGTCGGTTTAGTAAAGAATAGTTGTTTGATTATTTCATGCAATACAATAAAGACTATTCAGTGTTATTTTACATTAGAGTACTGAATTTCTGTTATTCAGTGCTGGTAATGTCCAACCGAAAACCATAAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3997
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 1034 5236 14 72
Genomic Location (Zv9):
Chromosome 17 (position 29741123)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29665050
GRCz11 17 29682013
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGTGATCCTGTGGGAGGATTCAATGGCACGTGTCACCCCCAAACAGGG[C/T]AGTGCTTGTGCAAGCCGTTTGTGACTGGGGATAAATGTGATGCCTGTGTG
Long Flanking Sequence:
CCTCTAGTTGACAGAACAAATTTTCAGCTCATTAAGAGTCTGTGGCTTTTATCAGCTGCTTTCGAGGGTGTCAGGCGCTTGGCCCCCGCATCACCCGCTGCTGGCCCCTCAGGGCCTTCCCTCCTCCATCCTCTACACCCCTCCCAGATGTGTCACTGACAGGTGCATCTGTGAATGCCTCCATTTAGAGCAAGTGTCCCCCCTTCCCTCACAGTCACACACGCCTCCAACACGCACACATACACTTTTTGCAACTCTTCGCCGGTCGGAGAGACTCACAGTTTTTTTTGTGTAAATAGATCTGGACTTGTTACTTTTGGTTAATTACCTGATTTCTTGTCCTCTACCGACATGGACAATGTCACAAGAAGTGATACAGTTTTTTTTTATCATATGAAAATGGTATTCGTGTCTCTTGTGATCTCCATGTGTCTAGGTGTGAGCCATGTGGCTGTGATCCTGTGGGAGGATTCAATGGCACGTGTCACCCCCAAACAGGG[C/T]AGTGCTTGTGCAAGCCGTTTGTGACTGGGGATAAATGTGATGCCTGTGTGGAGGGAGCCAGTTTCATGGATCCAAACAACTACCTGGGCTGCAGCAAAGGTGTGAACCTGAATATATTCATGAATTCATTGTTGAATTCATTGTTGAGTATTCATGAATTCAGTGTTGTTTTTTTGTTATATGTATTAATATGTTTTTTTGTTTATTTATTTGGGAATTTTTGAGATTTAAAAATATAGGTAGCACTTATAGTAAGGTCCCATTAGTTAATGTGTTTACTAGCATGAATAATCAATAAACAATGTTTTTAATTTTTATTAATCTTTGTTAACGTTATTTAATGAAAACAAAGGCATTTGGTGTTAGTTTATTCATTCATTAATTCCTTCCTTTTCTTTTCGGCTTAGTCCCTTTATTAATCAGGGGTCGCCACAACCCATCTTTTGGAAACACCCAAACACTCTCAATTACACACATACACTACAGACAGTTTAGCTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36443
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 1671 5236 23 72
Genomic Location (Zv9):
Chromosome 17 (position 29688630)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29612557
GRCz11 17 29629520
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGCACCATCATCGGGCAGAACACTGGGGTCTTTATAGGAGGGATTCCA[G/T]AGAATTTCACTATTCTGAGACAAGACGCTGGTAAATCATCTCTGAATATT
Long Flanking Sequence:
ACTTTGTGGTTGTTGGGCTGAAATGGGTTAATATAATAATAAACAAAAATGAATTATATAACCAATTATATAACCAATTATATAACCAACTGAAATTATCAATGCGAAACAAACTATAAAAAAAAAAACTAAAACAAAACATAACATATAGAATAATATAATAAAATAATATAATACATAGATGATAATATAAAATTGATTTCATATAAAGCAGACGCTGGTTATCACAGATTTCAAATTCTTCAGTATGTTATGTTTTTTTATTTTATTTTAAAGAGTACCCAACATTGAAACAGTAAAGTTAAAAAAACTGCTGTTCCCTGCTCTGATTATTGGGCTCGTCAGGAACAGTCCCAGAAGAACATTATTGTATTGATTTAGCATTGGCACGTGTTCAGGGGTTTCAGGTCATATTTTATTCTCCAACAGGATCAGCATCAGCTACAAGTGGGAGCACCATCATCGGGCAGAACACTGGGGTCTTTATAGGAGGGATTCCA[G/T]AGAATTTCACTATTCTGAGACAAGACGCTGGTAAATCATCTCTGAATATTCTATGGAAGGGTATTGTAGTAGAAAACTGAAGCAAGAAGTGTATATTAAACAATATATCATATACTCTATACAGGGCAAGCAAAGCTGGTGCAACAGGGGTTTGCTGGGTGCTTGAGGGATGTTTTGGTTCAGAAATCCAGTGGCGCTAATGAAGCTTGGGAACCTCTGGACTGGGAATCTGCACTAGAAACACATGAGACGTATGAAAGCTGGGAGGGCTGTCCTGCTGTTTCTGAAAATGGGGCATACTTCCTTGGACATGGTAATTTTCTTGGGGTCTGGTCTTTAGTAGTTAAAGGGAAAGTACATCGAAAACTTAAACGTCTGTCAATATTTACTTCTGTCATCACAAAAAGCTGATTGAATTGTTTCAGTTCAACACACAAGAAGTTATTTAAAAAAAATATTTGAAACCTCTAACCATTGACTTCTATTGTATTTGTTTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39166
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Essential Splice Site 2037 5236 29 72
Genomic Location (Zv9):
Chromosome 17 (position 29680338)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29604265
GRCz11 17 29621228
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTCGTCCCCCATCAGCGCCACCTTCCCCCACTCTCAGCACCTGACAGG[T/C]AAGGGCCGCGCAGTCCGCCTGGAGCTCGCCACTGACACCTTTTAACCCTT
Long Flanking Sequence:
GCAAGTCCGTCGTTTGATGGGTGTGAAATATAGCCCAGAATGAACGCGGGATGTACAGTCATATTAAATCAGTGCTGAAAAAGTTACAACTCTAATAAATTGTATTTATGCTAATGGTTAGATATGATTTACTGTGTCTATTAAAAGTGAGGAATGTGTGTGCTGCTTTTCTTTGGCCTGACACACACTTTCTCTCCTTCCCAATTGGATTCTCACCCTCTCTCGTTCCTCTCCTCCCCCTTACTTTGCCTCTTTCTCTCTCCTGTTTTTTTTCTTTCCTCTCTCTCTCGCTCTCCTATTATTTCCTATACAGTTCCACAAAGTGTGCTGCCTCCCTCCAGAGTTGGCAGTGTAAATGGTTCGAGCGTGGAGGTGAGCTGGGAGGAGCCGGCTGAGGTCAGAGGTGTAATTGAGAAGTACGTACTGAAAGCGTACAGCCGGGACCGTCCCTCCTCGTCCCCCATCAGCGCCACCTTCCCCCACTCTCAGCACCTGACAGG[T/C]AAGGGCCGCGCAGTCCGCCTGGAGCTCGCCACTGACACCTTTTAACCCTTGTGTGCTGGTTGGGCTCTTAGACCCCTGGACTGTTTTAATAGCTTGAAAAAAATTTACTTAACATTAAAGGTTGATTGTTTAGGATGGCATAAATTTGAAGGGGAAACAAGTTTTTATTTTATTTTATATATGTTGTGTATATTTTGAATTTACTGTAATTTTAGTCTGAGCTGAAATGTCCAAAATAAAGACTCTCTTACACTGTCGATACAAAAATGAAAAGTGCTGATAGATCATTGTTAATTTTTGGTACTGACATTCTTTCAAACACTTAAGAACTTCAATAAAAGTCACTTTATTAAACTGCAGTTAAGTTTTGAACCTTGAAAGTTTGCATTATGCATTTCCAAATTGATAACAAACAAAAAAAAATAGTAAATCACATGTTATAGAACATTTCTGTTTAAATATACAACTTTTAATCAAAGGTTTTGGTTTTACAGCGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13155
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 2140 5236 32 72
Genomic Location (Zv9):
Chromosome 17 (position 29664186)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29588113
GRCz11 17 29605076
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NCCCTCTCTCTATCCAGACGTTGGTGTGTTCACTCCWCATAAGYTGCTGT[T/A]GAGTGCCTGTACTGAGGCAGGATGTACCAACAGTRCCCAGGTTACCCTGT
Long Flanking Sequence:
TTAATATAGAAACTATTCATAAAATCACTTTGCCTTTCCAGTCATATTTATTTTTATAGGTTTTGTAATAACGCAGGGGTTGGAACACTTTTGTACCTTTTAAATGAGAACAATTGCATACCTTCATTTCAGTGGTACCATAAAAGGCACAGAACAGTACCATAAGAGGTCTCTTCTGTACCATATTTAATTGTCATACACAATTTTTACAAAGGTAAAGAACTGTTCCTTGTTGAACATTATTTGGACCATAGCGTACCTTGTATTCTGAGACTGTACTGTAGTAAGCTGTAATACAGACTCAACATTGCACATCCTCCAATGTGACTATTAAAGATGCACACAATGAAATGTCGATGCTGAAACGATAAACCATGTTGTAAGCCCTATTCCAAACTGTATTTGACAAGGTTTCATAGTATTTTTCATATTTTATTCATGTTTTTTTTTTCCCTCTCTCTATCCAGACGTTGGTGTGTTCACTCCTCATAAGCTGCTGT[T/A]GAGTGCCTGTACTGAGGCAGGATGTACCAACAGTACCCAGGTTACCCTGTTTACAGGCCAGTTGCCTCCTACTTATGTTGAGCCCCCCATCCTGACCGTGTTGGATGCCCGCAGTATCCACATACAGTGAGTATGACCAAAAAAAAATAAATTAATGTCACAAATTATACAGTACGTGGATTTTTTATGGAGTTTTTTTTATGTATTTAAACTGGTTTTATGTAAAAAATGTTGTCCCTAGAAAAGGAGAAAACACATTTAACCCTCCCTAGGTCTCGTCCTTGAACAGCTCACACAAGCACATGAACACTAACAAGGCATGAACAGAAGTGAAGATGGCCGTTCTCACCTTTTATAAGGCAATGTTTTATCAGAGAGATACGCTAATGAGGTGACAGACATTTGCTCTCTGCAAGAGGACAAAACGCATCTCAGGTCTCGTTATTCCTCACCATTATACAAAAAATAGCCTGCACATGTCAAAGCCATAACCCCTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23105
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 2378 5236 36 72
Genomic Location (Zv9):
Chromosome 17 (position 29647621)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29571548
GRCz11 17 29588511
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTACGAGCCAAGTGGGAGGCTCCCGCTGAACCCAACGGCAATCTAACCTA[C/A]ACAGTCCTCTTCGCAGGGCCAGGTAAATCAAACTTAACTGCTCCCCATCG
Long Flanking Sequence:
TGTTTTGCTTTGCTTGGCTTTGCTTTTTTTGCGAAATTATTTTAGACATATAACAAATGGTTACATTTTGATTGATAGTCCTAGTTCCAAGCAGAAAATAGGTGCATACCAGTTATGCAGTAATCTATTCAGATAGATAGATTGTTAGATGGATGGATAGATGGATAGATAGATAGATAGATAGAGAGATAGATAGAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATCATTATAGTGTATAGTGCTTTATTTGGGACACCACTAATATATTTATCTCGGTTCTTAGGTGGAAAGCAGGACTTTAGAGATGCCCCCCGTTGGCCATGTGACCCTTGTTGTCTTCAGCGAGACGCCACATTCAGTACGAGCCAAGTGGGAGGCTCCCGCTGAACCCAACGGCAATCTAACCTA[C/A]ACAGTCCTCTTCGCAGGGCCAGGTAAATCAAACTTAACTGCTCCCCATCGCTTCTCCACATCCCCCTCAGTTCCTCCGAGTGAACGCAACACTGCCTCCCTGCATGCTACCCCTGCTCCTCATATTGACTTCTGCTGTTTTCCCTTTGTTTGTTTACAAACAAAAATGCTGAAAGGTCAGTGAACCTTAGCACACCCTGCCTGCGCGGTAATAGGCTTAAATGAATTGTTGTCGGCCTCCATTTTGCTCAGGCTGACTATAGCAGGCCGGAAGGGCTTCAAGAGGACACCCGTACTCATCACACGCTCTTCTCCTCTCATTCTTCACGGGATGAAAGTGGACAGGTTTGTTAAAAAGCGTAATGGCACGTTCAAAAGGAATCTCCCGATGCTCGGTTGGAGCTTCCCCTATGCTGGTTAGAGGATAAACGCTTGCTGTAATGAGAGGGTGAGGGGTGCAAACACGCGTTCTTTATGTGAGTCTGTCAAGATCATGAAGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28879
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3146 5236 47 72
Genomic Location (Zv9):
Chromosome 17 (position 29574829)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29498756
GRCz11 17 29515719
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGATCAGTTAAACTAGAATGGACATCACCTGGTCGGCCCAATGGCATTT[T/A]GGGAGGGTATGACGTGTGGCGGAGGACTCTGAAGCGGTGTGAGGATCTGC
Long Flanking Sequence:
ATAAAGCATTATTTTTGAATTCCTTTACAACCTGACTTCATTTTTTAACAACATAATTTTTAATACATGTTATTTTTTCATGACCTGGTACAATATTTTACCCGATATCTCAAAGTAAGCAGTAGTGAACAAAAATTGCTCTTTTCTGTGGAAAGCCAGCTCTCCTGCATGATGAGTGGAGAGAAAAATCAATACAAGAAGTACATCTGAAGAAGAAAAGATGACACATATCATAACTCATCCTGCACAGCACAATCTATTTGGCTCTAGTATATCAAGTTGTAGAAAGTGCTATATAACGAGGCGATTAGCACTATTTTTTCTTTTATATTACATGCTTCTTCCCTGTGACAGTGATGGAAGAAAAACAAAGTGTGTAGTAACGCCAAAGAGTATATACACAGTAGTGAGCAGTATTTGTGAAGCTAAAATTTTGTTTACCGTATGTTTCAGATCAGTTAAACTAGAATGGACATCACCTGGTCGGCCCAATGGCATTT[T/A]GGGAGGGTATGACGTGTGGCGGAGGACTCTGAAGCGGTGTGAGGATCTGCAGACCCAGCAGACATTTGCTCCTCAGAGTCGCTGCTCGTACCTGGAGTGTCCTGCTGAACAAGACTTCTGTGGAAAGACTTGTTATAACCCTGAGATGCAGGTAACAACTTATATAAAATCTCTGGTGTCCCCAAATTGTATCTGTGAAGTTTAAGCACCAAATACAGGTCATTCATGATAGCTAGTCAAATGTGCCCCATATTTGGTTAATAGAAAAGCATGGAACTTTTGGGTCTGTCCCTTTAAATTCAAATAGGCGAACTGGGCAGAGACCTTATATGCTTTTTTGACACTCCAGAAACAACAAATCTAGCAAATCTCACACAAACAAAACTGTATTAAAGTCGAACTAAAGTATTAGGGCTGGGACACACAAAGCCAGCGGTCGGCAGCTGGGCTTGGTTGGTCCATTGGACTGCATTAGTCAGGGGTGCATTTCCGTAAACCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28878
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3187 5236 47 72
Genomic Location (Zv9):
Chromosome 17 (position 29574707)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29498634
GRCz11 17 29515597
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAGAGTCGCTGCTCGTACCTGGAGTGTCCTGCTGAACAAGACTTCTGT[G/T]GAAAGACTTGTTATAACCCTGAGATGCAGGTAACAACTTATATAAAATCT
Long Flanking Sequence:
TAGTGAACAAAAATTGCTCTTTTCTGTGGAAAGCCAGCTCTCCTGCATGATGAGTGGAGAGAAAAATCAATACAAGAAGTACATCTGAAGAAGAAAAGATGACACATATCATAACTCATCCTGCACAGCACAATCTATTTGGCTCTAGTATATCAAGTTGTAGAAAGTGCTATATAACGAGGCGATTAGCACTATTTTTTCTTTTATATTACATGCTTCTTCCCTGTGACAGTGATGGAAGAAAAACAAAGTGTGTAGTAACGCCAAAGAGTATATACACAGTAGTGAGCAGTATTTGTGAAGCTAAAATTTTGTTTACCGTATGTTTCAGATCAGTTAAACTAGAATGGACATCACCTGGTCGGCCCAATGGCATTTTGGGAGGGTATGACGTGTGGCGGAGGACTCTGAAGCGGTGTGAGGATCTGCAGACCCAGCAGACATTTGCTCCTCAGAGTCGCTGCTCGTACCTGGAGTGTCCTGCTGAACAAGACTTCTGT[G/T]GAAAGACTTGTTATAACCCTGAGATGCAGGTAACAACTTATATAAAATCTCTGGTGTCCCCAAATTGTATCTGTGAAGTTTAAGCACCAAATACAGGTCATTCATGATAGCTAGTCAAATGTGCCCCATATTTGGTTAATAGAAAAGCATGGAACTTTTGGGTCTGTCCCTTTAAATTCAAATAGGCGAACTGGGCAGAGACCTTATATGCTTTTTTGACACTCCAGAAACAACAAATCTAGCAAATCTCACACAAACAAAACTGTATTAAAGTCGAACTAAAGTATTAGGGCTGGGACACACAAAGCCAGCGGTCGGCAGCTGGGCTTGGTTGGTCCATTGGACTGCATTAGTCAGGGGTGCATTTCCGTAAACCATCGTTTACCAACTAAGGTTGCAAGTTGCATCGTTACAAACATAGTTAGTTGAATTGGTGTTTCCCAAATCCATCTTTCCAACGAAGATTCGCAAACTGCAATGCAAACTTGTACGCTTGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11300
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3256 5236 49 72
Genomic Location (Zv9):
Chromosome 17 (position 29569538)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29493465
GRCz11 17 29510428
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTATAATATTACAACATATATKTATGCATGTGTTTTGTAGGAGAGRTCTG[T/A]TGTCTGGACTCTGTGGAGYAGCGTGTATCAGTGGGTCTCGGGGACTCGTG
Long Flanking Sequence:
CGCTGGAGAGAATCTATCCTGCCCTGATTTCTCGCCAAAGTAGGCAGTGGAGTCCGGCTAAATATAGCCCGCCGCTGTGGAGCGAAGAGGTGGGCTGGATTTCTACCTGCGCCTCTGTGGGCCCTCAGGACCGGAGCGTTGCCACCTCTTAACTTCTTAATTGCCTCGAGGAGTGCAAAACTTTGTTGATAATGTATTTGAATTGCATATATTTTGTGCGTGTGCTCTATTGTTTCAGATTTGCTGCTCAGGGACCGTTCACAACTTAATTCAGTCTCATCAGTGCTGTGAAGAGCGATATATTCCTGCTTCAGAGGATTCAGGGAGTGTGTGTTGTGGAGGTCAGTTTGTCCAGCCTCTGTCTCAACACCAGTGCTGTGGTGGATATCACGTACTTGTTTCACCAGGTATCTACTGCATTCAGTTCTTATCTCATTTATATTTGTTATTGTATAATATTACAACATATATTTATGCATGTGTTTTGTAGGAGAGGTCTG[T/A]TGTCTGGACTCTGTGGAGCAGCGTGTATCAGTGGGTCTCGGGGACTCGTGTTGTGCTGGGCGTCCTTTCGTCTCAGGAGTGGGACAGATCTGCTGTGGGGGTCGTCTGTATGATGGCTTCAAGTCCCAGTGCTGTGGAGGACAACTAGTCCCTAGAGAAACAGAGTGTTGTGGGGATGAAGAAGAAGGGATATCCTATGAACATGTGTCAGGTGAGCTTTTAGAAACATTCTTGCTGAAAAATGGTTCTGTTTTAAGTAGGGATGAACTGAATTTTTGACTGACAAAAATTAACGGTCGAAAATATAATTTGCTGTTTTCATCTAAGAGAGCAAAAAAGATAAAAGTATGAGGGGGGAAAAGACTCCTCCACAGTGTTCAACTCGCAGGTCTCATAGACTGATTTCACGCGGCCGCCATTTAAAAAGTGAAATTGAGGCTGTGGTGGGAAGAAATTCTGAAGTATCGCCTGAGTCACGCAGTAATGTTGTGTACCTAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1881
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3263 5236 49 72
Genomic Location (Zv9):
Chromosome 17 (position 29569519)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29493446
GRCz11 17 29510409
KASP Assay ID:
554-1871.1 (used for ordering genotyping assays)
KASP Sequence:
ATTTATGCATGTGTTTTGTAGGAGAGRTCTGTTGTCTGGACTCTGTGGAG[C/T]AGCGTGTATCAGTGGGTCTCGGGGACTCGTGTTGTGCTGGGCRTCCTTTC
Long Flanking Sequence:
TGCCCTGATTTCTCGCCAAAGTAGGCAGTGGAGTCCGGCTAAATATAGCCCGCCGCTGTGGAGCGAAGAGGTGGGCTGGATTTCTACCTGCGCCTCTGTGGGCCCTCAGGACCGGAGCGTTGCCACCTCTTAACTTCTTAATTGCCTCGAGGAGTGCAAAACTTTGTTGATAATGTATTTGAATTGCATATATTTTGTGCGTGTGCTCTATTGTTTCAGATTTGCTGCTCAGGGACCGTTCACAACTTAATTCAGTCTCATCAGTGCTGTGAAGAGCGATATATTCCTGCTTCAGAGGATTCAGGGAGTGTGTGTTGTGGAGGTCAGTTTGTCCAGCCTCTGTCTCAACACCAGTGCTGTGGTGGATATCACGTACTTGTTTCACCAGGTATCTACTGCATTCAGTTCTTATCTCATTTATATTTGTTATTGTATAATATTACAACATATATTTATGCATGTGTTTTGTAGGAGAGGTCTGTTGTCTGGACTCTGTGGAG[C/T]AGCGTGTATCAGTGGGTCTCGGGGACTCGTGTTGTGCTGGGCGTCCTTTCGTCTCAGGAGTGGGACAGATCTGCTGTGGGGGTCGTCTGTATGATGGCTTCAAGTCCCAGTGCTGTGGAGGACAACTAGTCCCTAGAGAAACAGAGTGTTGTGGGGATGAAGAAGAAGGGATATCCTATGAACATGTGTCAGGTGAGCTTTTAGAAACATTCTTGCTGAAAAATGGTTCTGTTTTAAGTAGGGATGAACTGAATTTTTGACTGACAAAAATTAACGGTCGAAAATATAATTTGCTGTTTTCATCTAAGAGAGCAAAAAAGATAAAAGTATGAGGGGGGAAAAGACTCCTCCACAGTGTTCAACTCGCAGGTCTCATAGACTGATTTCACGCGGCCGCCATTTAAAAAGTGAAATTGAGGCTGTGGTGGGAAGAAATTCTGAAGTATCGCCTGAGTCACGCAGTAATGTTGTGTACCTAGCTGTATATCTTGTTAGCGAAG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa39165
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3488 5236 52 72
Genomic Location (Zv9):
Chromosome 17 (position 29539362)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29463289
GRCz11 17 29480252
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGACTAGTTGTTTTTGTGACTGTGTTTCAGACACTGAGCTGGAGCCGTA[C/A]AGCAGTTATGAGTATAGGGTTGGTGTGTGGAACAGTTTTGGCCGTGGGTT
Long Flanking Sequence:
TATTATAATTTAAGGTTTTTAAAAATTTGTAAAAAAAAAAAATAATAAATAAATTTTTGCACTTTTTTGCACATTTGTAAAAAATCTAATTACTATTTTAATCTGTAATTTATTTGAAGGAAAATTTGTGAATTGACTGTTCAAATAGACACCCTTTTTTATAGCTCTAATTTATTTTAAAAAATAATAAATAAGTTTTCTTGGTTACCTTTGTTGATCTGCTATGAAACAGTGTCCTCTGGGAAGGATATTTTATCATCCTGTCACTTTTAGAAGTGCTTCTGTCTGTCTGATGAAACCCATCACAAAGATTTACACTCATAACTTCCTGCACATGCGTTTACAACAAACCACTGTATTTCTGATAACAAAGAGCATTACAGTAAGCGCAGGTCTCCTGCTGCCCTTTAAACTGTACTTTTGTTTTAATGTGAAGCCTGGGATGCTTTAGAGACTAGTTGTTTTTGTGACTGTGTTTCAGACACTGAGCTGGAGCCGTA[C/A]AGCAGTTATGAGTATAGGGTTGGTGTGTGGAACAGTTTTGGCCGTGGGTTCAGTGTCTGGACTCGTGTCAGGACAGATGAAGATGTGCCCTACAGTGTGTCTCCTCCGAACTGGAGTCATGTGGGTCTGCGTGATGACATCATCCAGCTGGAATGGTCTGCCCCAATCAAACCCAATGGTAATGACCTCCAAATATATAATTACCTCCAAATATATAATTACCTCCAAATGTTGAAGTCAGAATTATCAGCCCCCCTGAATTATTAGACCGCTTGTTTATTTTTTCCCCAATTTGTGTTTTTACAGCAGATTTTAACTAGGCAGGTTAGGGTAATAAGGCAAGTTATTGTATAACAATGAATTGTTCTGTAGATTATCGAGAAAAAAATTTAGCTTAAAGGGGCTGATAATTTTTTCCTTAAAATGGTGTTTAAAAACTAAAAACTGCTTTTATTCTAGCCGAAATAAAACAAATAAGATTTTTTTCCAGTAGGAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13319
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Essential Splice Site 3548 5236 52 72
Genomic Location (Zv9):
Chromosome 17 (position 29539182)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29463109
GRCz11 17 29480072
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGTGAKGACATCATCCAGCTGGAATGGTCTGCCCCAATCAAACCCAATGG[T/C]AATGACCTCCAAATATATAATTACYTCCAAATATATRATTACCTCCAAAT
Long Flanking Sequence:
AAAATAATAAATAAGTTTTCTTGGTTACCTTTGTTGATCTGCTATGAAACAGTGTCCTCTGGGAAGGATATTTTATCATCCTGTCACTTTTAGAAGTGCTTCTGTCTGTCTGATGAAACCCATCACAAAGATTTACACTCATAACTTCCTGCACATGCGTTTACAACAAACCACTGTATTTCTGATAACAAAGAGCATTACAGTAAGCGCAGGTCTCCTGCTGCCCTTTAAACTGTACTTTTGTTTTAATGTGAAGCCTGGGATGCTTTAGAGACTAGTTGTTTTTGTGACTGTGTTTCAGACACTGAGCTGGAGCCGTACAGCAGTTATGAGTATAGGGTTGGTGTGTGGAACAGTTTTGGCCGTGGGTTCAGTGTCTGGACTCGTGTCAGGACAGATGAAGATGTGCCCTACAGTGTGTCTCCTCCGAACTGGAGTCATGTGGGTCTGCGTGATGACATCATCCAGCTGGAATGGTCTGCCCCAATCAAACCCAATGG[T/C]AATGACCTCCAAATATATAATTACCTCCAAATATATAATTACCTCCAAATGTTGAAGTCAGAATTATCAGCCCCCCTGAATTATTAGACCGCTTGTTTATTTTTTCCCCAATTTGTGTTTTTACAGCAGATTTTAACTAGGCAGGTTAGGGTAATAAGGCAAGTTATTGTATAACAATGAATTGTTCTGTAGATTATCGAGAAAAAAATTTAGCTTAAAGGGGCTGATAATTTTTTCCTTAAAATGGTGTTTAAAAACTAAAAACTGCTTTTATTCTAGCCGAAATAAAACAAATAAGATTTTTTTCCAGTAGGAAAAACATTATCAGGCAACCTGTGAAAATTTTCTTGCTCTGTTAAACATCATTTTGGAAATATTTAATATTAACTCATTTCTAATCAGCCAATCACAGGGAAGCAACCTTAATGCATTTAGGCATGTAGACACAAACCAAGCATCAAAATGGGGCTGAACGGTGATTTAAGTGATTTTGAACGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14237
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3824 5236 58 72
Genomic Location (Zv9):
Chromosome 17 (position 29500079)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29424006
GRCz11 17 29440969
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACTTTCTGTTTCCGTTTGCTTRTAGGTGTGTATAATTTAAGTTTCCCTT[T/A]GGAATATAACAYCCTGCTCAACGCAGGCACTGAGCGGCCACTCATTCGTT
Long Flanking Sequence:
TTGGCTCTCATAAATGTTGAATAACCTATCAGCCTCCAGTTGCCGTAAATTATGAAAGGCGCTAGTGATGGGAATATTAACAAAGCGTGGGTGCCAGGACTCTACATTCTTTAGTTCAAATGCATTACAGAAGAGCATGAGCGTGTCTGTGTGTTTCGGACAGCGCTGGGATAGACGGATCAGGGGAAGTGCCTGCTTGCCCAGATGGATGTTGGATCAAGGGCAAAGCTTCCAAAAGTGTCATATCCACTGTGTGTCAGTTCTTGCGCTGTAGTATAAGTACATACTGCGATTGTGGAAAGGATTGCGTGTTTGTTTTGTCACTAATAATTTTGTTTAGTGATTGGTGATTGTATTTATGTCGGGTTTCTACAATTTAAACCTGCTTTGACAAGCCTGTAATGCTAATTTCCTTGGATATACAGTAAGTGAGTTAAAACAATTGAATGTGACTTTCTGTTTCCGTTTGCTTATAGGTGTGTATAATTTAAGTTTCCCTT[T/A]GGAATATAACATCCTGCTCAACGCAGGCACTGAGCGGCCACTCATTCGTTCTGCTGGACTAGAGCAATTCCTGCTACTGCAAGGACTGGACCCCTATACCATCTACCATGTCCAAGTACAAGCCTGTCAGCCAGGTACTCTGGAAGCTGAAATGTGCTCAACATTAAGAGACAGTCAAAACATGATATGATTAGGGGGATATTTCAGCTTAGGAGGAGACATCAGCAATTATAATTCTGGAAATATATATGTATTTTTTTACTTTTTTATATACATTTAAACATTTTACAGAACTGAACAGTCAGTGACAGCAGCAGCTATTTTTAAAAAAATAGTTAAATAATAATAATAACACTACCAGTAAAGAAAAACAAATTACAAAAAAACACATTCATAATTTTCCAATTTTAAAGGGTACACCTGGGAATATTATGTCCTGTTGCCATGTTCAGATACATAGTAACAAGTGCCCATCTTTGTCTAAAAATATCAATTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18585
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3826 5236 58 72
Genomic Location (Zv9):
Chromosome 17 (position 29500072)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29423999
GRCz11 17 29440962
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTCCGTTTGCTTRTAGGTGTGTATAATTTAAGTTTCCCTTWGGAATA[T/G]AACAYCCTGCTCAACGCAGGCACTGAGCGGCCACTCATTCGTTCTGCTGG
Long Flanking Sequence:
TCATAAATGTTGAATAACCTATCAGCCTCCAGTTGCCGTAAATTATGAAAGGCGCTAGTGATGGGAATATTAACAAAGCGTGGGTGCCAGGACTCTACATTCTTTAGTTCAAATGCATTACAGAAGAGCATGAGCGTGTCTGTGTGTTTCGGACAGCGCTGGGATAGACGGATCAGGGGAAGTGCCTGCTTGCCCAGATGGATGTTGGATCAAGGGCAAAGCTTCCAAAAGTGTCATATCCACTGTGTGTCAGTTCTTGCGCTGTAGTATAAGTACATACTGCGATTGTGGAAAGGATTGCGTGTTTGTTTTGTCACTAATAATTTTGTTTAGTGATTGGTGATTGTATTTATGTCGGGTTTCTACAATTTAAACCTGCTTTGACAAGCCTGTAATGCTAATTTCCTTGGATATACAGTAAGTGAGTTAAAACAATTGAATGTGACTTTCTGTTTCCGTTTGCTTATAGGTGTGTATAATTTAAGTTTCCCTTTGGAATA[T/G]AACATCCTGCTCAACGCAGGCACTGAGCGGCCACTCATTCGTTCTGCTGGACTAGAGCAATTCCTGCTACTGCAAGGACTGGACCCCTATACCATCTACCATGTCCAAGTACAAGCCTGTCAGCCAGGTACTCTGGAAGCTGAAATGTGCTCAACATTAAGAGACAGTCAAAACATGATATGATTAGGGGGATATTTCAGCTTAGGAGGAGACATCAGCAATTATAATTCTGGAAATATATATGTATTTTTTTACTTTTTTATATACATTTAAACATTTTACAGAACTGAACAGTCAGTGACAGCAGCAGCTATTTTTAAAAAAATAGTTAAATAATAATAATAACACTACCAGTAAAGAAAAACAAATTACAAAAAAACACATTCATAATTTTCCAATTTTAAAGGGTACACCTGGGAATATTATGTCCTGTTGCCATGTTCAGATACATAGTAACAAGTGCCCATCTTTGTCTAAAAATATCAATTTTAGTAGAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23104
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 4183 5236 62 72
Genomic Location (Zv9):
Chromosome 17 (position 29467720)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29391647
GRCz11 17 29408610
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCACCACAGAAGAGGCCATCCCATCCTCTCAACCAGCCCCCACAGTCTA[T/G]CAGGTACATTCCCGCAGTGTGGAGCTCTTCTGGTCTCCACCAGCCCAGCC
Long Flanking Sequence:
GGGTAATGTTTTTCAGGCTTATGTGTTTGGTTTAGAGCCTTACACCACATATAATATTCGTGTGGAGGCAGTAAATGGAGCAGGTCAGGTGTCAAGTCCCTGGACCACCATTCGAACCCTAGAAGCCTCTCCGAGTGGCCTGGCCAACTTCAGCGTTGAGAGAAGAGAACATGGCCGAGCTCTGCTGCTGCAGTGGGCAGAACCTGCTTCTCCTAATGGAGTCATCAAAGTATGTAATCCTTGGTTACATCATAACAGTCACGCTTCAGAATCACCCCTCATTTAACACATTCTTCTCCACAGATGTACAACATCTTCAATGAGGACAACTTGGAGTTTAGCGGCCTCGCACGCCAATTCCTCTTCCGCCGTCTGGAGCCCTACACAGTGTACACACTCATTTTGGAAGCTTGCACTGAAGCAGGCTGCACCAGATCTGCTCCTCAACGGGTCACCACAGAAGAGGCCATCCCATCCTCTCAACCAGCCCCCACAGTCTA[T/G]CAGGTACATTCCCGCAGTGTGGAGCTCTTCTGGTCTCCACCAGCCCAGCCCAATGGCAGGATCCTGCAGTACCAGCTTCTGGCTGTACGTCTGGAGGACGGCAGGGTGCGCAGTGATGAAGATGACTCCTTGAGAGCCAAGATCGTCTTTATCCAGAACAACACCCAGGCTAACAGCTTCTCCTATAATATGTCTGGCCTCCTGCCCTGGAGCAGGTACAAGTTTCGTGTGCGTGTCTCAAATGCGGCAGGGTTTACTGATAGCCCCTGGCTCACGGTTCAAACCAAACAAGCTCCTCCAAGAGGACTGGCTCCTCCGTCTGTCAGTCACATAGAGGGCAAGCCTAATGAAGTCTTCGTAGCTTGGACGCCTCCATTGGAGCCCAATGGGGTTCTTCTCACCTACAGGATTCAGAGGGATAACATTGGCTTTCATTTCAGCTTTGATTCGAGTGTGTTCAACTACACAGATGTGGATTTAAACGCATACACTCTCTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28877
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 4346 5236 62 72
Genomic Location (Zv9):
Chromosome 17 (position 29467231)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29391158
GRCz11 17 29408121
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTTTGATTCGAGTGTGTTCAACTACACAGATGTGGATTTAAACGCATA[C/A]ACTCTCTACAGTTATGCAATCATTGCCTGTACCGTGGCAGGATGTGTTAC
Long Flanking Sequence:
CCCACAGTCTATCAGGTACATTCCCGCAGTGTGGAGCTCTTCTGGTCTCCACCAGCCCAGCCCAATGGCAGGATCCTGCAGTACCAGCTTCTGGCTGTACGTCTGGAGGACGGCAGGGTGCGCAGTGATGAAGATGACTCCTTGAGAGCCAAGATCGTCTTTATCCAGAACAACACCCAGGCTAACAGCTTCTCCTATAATATGTCTGGCCTCCTGCCCTGGAGCAGGTACAAGTTTCGTGTGCGTGTCTCAAATGCGGCAGGGTTTACTGATAGCCCCTGGCTCACGGTTCAAACCAAACAAGCTCCTCCAAGAGGACTGGCTCCTCCGTCTGTCAGTCACATAGAGGGCAAGCCTAATGAAGTCTTCGTAGCTTGGACGCCTCCATTGGAGCCCAATGGGGTTCTTCTCACCTACAGGATTCAGAGGGATAACATTGGCTTTCATTTCAGCTTTGATTCGAGTGTGTTCAACTACACAGATGTGGATTTAAACGCATA[C/A]ACTCTCTACAGTTATGCAATCATTGCCTGTACCGTGGCAGGATGTGTTACAAGTGGTCCGACACAAATCAGGACGCTAGAAGGCGCCCCTGCTACTGTGGATTCTCCTATATTGTCTGACATCACATCCTATTCACTCAATGTGTCTTGGACTGTTCCATCCTTCCAGAATGGGGAGATTGTGGTGTATATTCTCAAAGTTAACAATGATGAGGTCTACCGTGGAAAACGGTTAAGCGTTCAAGTTTTGGATCTTCAGCCTCATGTTTCCTACAGCATCATCTTGACGGCCTGCACCAATGGAGGCTGCACTTCGAGTTCTCCTATTCTAATACAGACAAGAGAAGCTCCGCCCTCAGGGATGCCTGCTCCTACTCTTAAAGTCACAGGTCCTGAATCAGTGGAGGTCACATGGAGAGAGCCTGTTCATCCTAATGGAGTGATCATGGGATACGAGCTCCGTCGAAACGGGAGCCTCATATACACTGGTACTGACACTCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2913
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 4561 5236 62 72
Genomic Location (Zv9):
Chromosome 17 (position 29466588)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29390515
GRCz11 17 29407478
KASP Assay ID:
554-2985.1 (used for ordering genotyping assays)
KASP Sequence:
TGGCCCGCACKCAAYCATCAGCGCCCTCTGGTGTTKCTCCACCCAGATTA[C/T]AGGCTCTGGGGCCATTCAGTGTTATGGTGAAGTGGGACCCTCCTGCAAGA
Long Flanking Sequence:
TGTCTTGGACTGTTCCATCCTTCCAGAATGGGGAGATTGTGGTGTATATTCTCAAAGTTAACAATGATGAGGTCTACCGTGGAAAACGGTTAAGCGTTCAAGTTTTGGATCTTCAGCCTCATGTTTCCTACAGCATCATCTTGACGGCCTGCACCAATGGAGGCTGCACTTCGAGTTCTCCTATTCTAATACAGACAAGAGAAGCTCCGCCCTCAGGGATGCCTGCTCCTACTCTTAAAGTCACAGGTCCTGAATCAGTGGAGGTCACATGGAGAGAGCCTGTTCATCCTAATGGAGTGATCATGGGATACGAGCTCCGTCGAAACGGGAGCCTCATATACACTGGTACTGACACTCGTTATCATGACTTCACCTTGCTGCCCAGCGTGGAGTACAGCTACACCATCACTGCCAATAACAGCGAGGGCGCCACTACCAGTCCTCCAGCGGTGGCCCGCACTCAACCATCAGCGCCCTCTGGTGTTGCTCCACCCAGATTA[C/T]AGGCTCTGGGGCCATTCAGTGTTATGGTGAAGTGGGACCCTCCTGCAAGACCTAACGGTGTCATCATCAGTTATTCGCTTTACAAACGGGACCCAGCTGAGAACAATGTGAAACGTTTTGTTTTTGCGTCACACCACAGTGCCTTCCAGAGCCGGAGTTTCTCTCTCAACACACTAAAGCCCTACTACAGGTACAAAACCAGAATGCATCATTTTCACATACTGTTTTTGATACATTTTGGTACAGGCAAATGTAGACACAACACTAAAAATATAAAACATAATTAATTTATTAAAACAGGTCAATTTACAATTTACAAAATTAATTATATAAACATAAGAAGCATCTTTTCTTTCTTTTTTTCGGTATATGTAAGCTCTTTAGTCACTTTAGTATTTCTAATGCAAAAATATTATAAATATCTTAACCATGAATTTTCTTATTTATGGTTTTTATATGCAGGAAAAAATAGTAAACGACTTTACATTAATAATAATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2905
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 4646 5236 63 72
Genomic Location (Zv9):
Chromosome 17 (position 29462786)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29386713
GRCz11 17 29403676
KASP Assay ID:
554-2793.1 (used for ordering genotyping assays)
KASP Sequence:
TGGAGGCCTGTTCWCTGTTAGGCTGTGCTGCCAGTGACTGGTCTTCAAYA[C/T]AGACGCTTGAATCGCCCCCTGCTGGTCARCCTGCCCCATTGCTGGAGCTG
Long Flanking Sequence:
ATTAAATTAAATTAAATTAAATTAAATTAAAAACAACAACCAGAAAACATAATTCAGAAATGTTAGTTGCAATTTAATCTAATTTAACAAAAAAATTAAATAAAAAAAACAACAAAAAAAACTTAATTAAAAATGCTAATTTTGTGGAAAATTTTAGTTTGTTCACATGTCAGTAGTTAGATTAAAACAGAAATAATAATACATTAAACCTAAAAAAAAAAAAATTACACAAAAAAATGTAAATAAAAGATAATACGTGAGAATTAAACTGTATGTAAACTATATAATATTTTATCACTAAAATAAGTGTTTGATAATTATGTATGTTTATAAAATGTATTATTATTTCATATTTATTTGCCACATTAATATAATGAATTGTTATGTTACCATAATTTATTGAATAATTATTTTGATTGTCAATATTTATTTCCAGATATGAGGTCAGAGTGGAGGCCTGTTCTCTGTTAGGCTGTGCTGCCAGTGACTGGTCTTCAATA[C/T]AGACGCTTGAATCGCCCCCTGCTGGTCAACCTGCCCCATTGCTGGAGCTGCAAACCAACCCTAAAGGCCTACAGACCGTCTTTCTGCTGTCCTGGTCTCCTCCCACCGAACCCAATGGGAAACTTCTGCACTATGAGCTCTACCGAAAACACCTCTCAGACATGGAGAGCAGATCTGTAACTACACTGGTTTACAGCGACTCCTCAACCTCCTGCCATGATGACAAACTCCAGCCCTACACTGCCTATGAATACCAGGTTTGACTCCCTGAATTTAACTGAATTTAAAAGTGATGTTTTCTAGTGTGTTTAAGTTTGAGGTTTTATGCGTAATTTACTGCATTACTGAGAGAATGATCAGAGTTAAATAGTTTTTTTTATATTTATATACAGTTGAGTGAGAATTATTAGCCCCCATTTGTTTTTTTTTCTTTTGAAATATTTCCCAAATTATGTTTTACAGGGCAAGGAAATTTTCACAGTATGTCTGATAATATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36442
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 4851 5236 65 72
Genomic Location (Zv9):
Chromosome 17 (position 29452026)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29375953
GRCz11 17 29392916
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCGAGGTCCCCTGAGTGAACTCCGCACCCAGGCCTCTGCCCCGGCACAG[C/T]AGCCCCCGCCACGACCCATCGCCCTCACTTCCCGCTCAGCTCTGGTGGAG
Long Flanking Sequence:
AACACCAAAAATGCCTGTTAGGAGTTAGTAGTGTTAGAGTTGGAGTTAGGGTTAACCCTAACCCAAAACTACAATCAGATGTCCCCAAATCACCATTAATTGTTTGAATGTATTTAAAGGAAAAAAGACTCTACTTCTTACCAAAAAAAAAAGCTTTTCATAAGCATCTTCACTTTTTGGTAATATCTTGAGCTAAATATTAAAAGGTTAAAAAATTAAGACATTTTTTCCGCAGCCTTTTTAGCTTATGTTTACTAAGGGTACCAATTAGTGGAGGGCACTGTATAAAGTGCCACAGTTGTATGTAAACAGAGCATTGATGTGGTACTAACTTTTATCTGTGCATGGAGCTGTCTGAGGGGACGTCCCACCAGCAGACTCTCCATGGTCTCAGGCCCTTCACAGTGTATTCTGTTGGCGTAGAGGTCTGCACCTGTTTCCTGTGCTGCAGTCGAGGTCCCCTGAGTGAACTCCGCACCCAGGCCTCTGCCCCGGCACAG[C/T]AGCCCCCGCCACGACCCATCGCCCTCACTTCCCGCTCAGCTCTGGTGGAGTGGGACATGCCTCTTCAGCCCAATGGCATCATTGAGAGGTGCAGAGTAATATTTATGTTACTTGGTTTAACTGTTCGATAACACTTTGCTTGCACACATTGTTGCTTGCACACATTGTTATTCCTGAGATAAAGAATTAATCCGTGCTGTTAATCTATTGCAAAAAAAGATCAAATCAAAGACTGATCTGCTTCTGCATTTGGAGTTGGATGCATTCGAAGAATGCATTCGAAGGGTGCAGCGTCATTGCTACACGACTAAGGCTGACTAATTTTAAAAAAATTAGAAGGCTCCTTCAAATGCAGCCTCAAAATGCATCCTTCGTTTACCTGGTAATGAAGGACATAACCGGTAGACCGTTTGTGACCTTGAACGTCCCAAGATTCATTGTGCACTGATAACGGCAGGACATTTTTAAAAGAAAACTCTGGATTAAATGTATGAATTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42957
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Essential Splice Site 5011 5236 67 72
Genomic Location (Zv9):
Chromosome 17 (position 29447479)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29371406
GRCz11 17 29388369
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACAGCGGCTTCCACAGTTTTCTACACATCCCACGCACCTCGGATAAAA[G/A]TATGAACACTGTGTGCCTCAGGCAGGACTCCATTTGACTCACAGGCCAGA
Long Flanking Sequence:
TAATTTTGACTACATTAATTAGTAGGACATAGTTTTTAATTTTTATCGTGGAATTTTGACTTTTTAATGCATTTTTTTTTTTACCTGGCAGAAATGGGCTTACATAGCTTTAGGTGTATTATTTGGGTTTTTCTTATATTGCATATATCTGTTTACTTCATTTTGCATATATATTTGTGTATTTTATTTTGCATATTTGGTGTGAATACGTTTAGTTTTGACTAGATAACCTTAAGACTAACATAAAAAATGATTTCAGTGGGACTTTATAAAAAATAGTTATGGCACATAAATCAATCCCCTCTGTCACTGTTTCCCTGTAGCTCCTCAGTATATGGAGGCATTTGTGGTGCACAGTAACCTGACCTCAGTGTTTGTGGACTGGAGTGGCTCTTTCTCTCTGAACGGGCCTCTGACAGAATACAGTCTAACCGAAAGCAGCCTGCGCGTCTACAGCGGCTTCCACAGTTTTCTACACATCCCACGCACCTCGGATAAAA[G/A]TATGAACACTGTGTGCCTCAGGCAGGACTCCATTTGACTCACAGGCCAGACTTTTTTAGTTCCCTTTCAGTATCCTTGTCTCTCATCATCTGTCCGGTCTCTTTTCTCTTCAGCCTTTGCATTCCAAGTGACCTGCACCACTGACAGTGGCAGCGCCAGTTCTCCTGTCATTAAATACAACACGGCCACTGGTATAGGTATGTTTCTTCAGGTCTGCCAAGTGAAGGTGACTGGAGAAAAAAAGCAGTGTCTCCATCCTGACTGTCTGAGTAGAGCTGTTCCCCTGCCAGTATCACTGTTGCAGACTTTATCAGAGTTATCACTGAAAAGCCTGTTCACTTTTTGGTTTTGACAAGGAAATTGATGTTTAAACTTCTTTTCAGAATTGCTATATACAGTAGCAGATGGCTGCAGTCAAACTGGATGAGCGAAAACTGTGAATTTTACCACCCTTATTGTTTTACTTATTATACAGTCAAATGGCCATAAATATAGTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14514
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Essential Splice Site 5012 5236 67 72
Genomic Location (Zv9):
Chromosome 17 (position 29447478)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29371405
GRCz11 17 29388368
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACAGYGGCTTCCACAGYTTTCTACACATCCCACGCACCTCGGATAAAAG[T/A]ATGAACAMTGTGTGCCTCMGGCAGGACTCCATTTGACTCACAGGCYAGAS
Long Flanking Sequence:
AATTTTGACTACATTAATTAGTAGGACATAGTTTTTAATTTTTATCGTGGAATTTTGACTTTTTAATGCATTTTTTTTTTTACCTGGCAGAAATGGGCTTACATAGCTTTAGGTGTATTATTTGGGTTTTTCTTATATTGCATATATCTGTTTACTTCATTTTGCATATATATTTGTGTATTTTATTTTGCATATTTGGTGTGAATACGTTTAGTTTTGACTAGATAACCTTAAGACTAACATAAAAAATGATTTCAGTGGGACTTTATAAAAAATAGTTATGGCACATAAATCAATCCCCTCTGTCACTGTTTCCCTGTAGCTCCTCAGTATATGGAGGCATTTGTGGTGCACAGTAACCTGACCTCAGTGTTTGTGGACTGGAGTGGCTCTTTCTCTCTGAACGGGCCTCTGACAGAATACAGTCTAACCGAAAGCAGCCTGCGCGTCTACAGCGGCTTCCACAGTTTTCTACACATCCCACGCACCTCGGATAAAAG[T/A]ATGAACACTGTGTGCCTCAGGCAGGACTCCATTTGACTCACAGGCCAGACTTTTTTAGTTCCCTTTCAGTATCCTTGTCTCTCATCATCTGTCCGGTCTCTTTTCTCTTCAGCCTTTGCATTCCAAGTGACCTGCACCACTGACAGTGGCAGCGCCAGTTCTCCTGTCATTAAATACAACACGGCCACTGGTATAGGTATGTTTCTTCAGGTCTGCCAAGTGAAGGTGACTGGAGAAAAAAAGCAGTGTCTCCATCCTGACTGTCTGAGTAGAGCTGTTCCCCTGCCAGTATCACTGTTGCAGACTTTATCAGAGTTATCACTGAAAAGCCTGTTCACTTTTTGGTTTTGACAAGGAAATTGATGTTTAAACTTCTTTTCAGAATTGCTATATACAGTAGCAGATGGCTGCAGTCAAACTGGATGAGCGAAAACTGTGAATTTTACCACCCTTATTGTTTTACTTATTATACAGTCAAATGGCCATAAATATAGTTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25043
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 5206 5236 71 72
Genomic Location (Zv9):
Chromosome 17 (position 29437965)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29361892
GRCz11 17 29378855
KASP Assay ID:
554-7749.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTCAAGATAAGAAATCATGGGACGCAGACCTGCATGCCACTGACAGC[G/T]GAATGGTGAGATAAACCTGTGAAATTTCTGTCATAAGGGATATTATAGCA
Long Flanking Sequence:
AAAGTGTTAACCAAATAGCTTTACACATGAATGCCTTTTGTGGCATTTACTCTCTTTTTGCATTGACAGTCACTCTCTTAAACTTAAATGAAAAAATAAAAAAATGTGTATTTCATAATGGAGATTTCACTTACTTTCCATTATGTTTTGGGTTTTGTTTCACCATCAACTGGTATTGCATGCCTGCAAAATGTATACATGTTTTGGTTATCTGTTCTTCTTTGACTACTGCATGTGACTAAGTGTGCAGTGATTGTTTGTGCTACTGTATATATTAATCTGCTGTGTGTTTGGTTGATCAGGGTTTGACTGATACTAAGATCGGAGGTACGTGCACCAGTAACCACAGCTATCAGGCCAGCATGTCTGTGCTGCGTGTGCCCAGTCAAAGCCAGCTGAGCCATGCCTACTCCCAGAATTCCCTGCATCGAAGTGTCAGCCAGCTGATCGACACTCAAGATAAGAAATCATGGGACGCAGACCTGCATGCCACTGACAGC[G/T]GAATGGTGAGATAAACCTGTGAAATTTCTGTCATAAGGGATATTATAGCAGTGATAATTTCAGCAAAATATAAAAAAACGAATCACCCTTTAAACAACACAATTTAACACAAATTATTATTATTTTTTGTATTGCCAACAACTGACTGTAAACTAGGCTGCATTAATAGTTAATAAATTAATTGATATATTTTTGTTGACTTGGGATTACAGTTAAGAAACAAAAACTGTAAACATATTTCTGACACTAAATTAAATTTTGTAGGTTATTTTTTTTTCTGACGTGTTTTAGTCAAAATTGCAGGATAAAAAAAGTCATGATTGCGAGAAAATGGCAGAATTTCTCCTATCTGTGATCGATTAACCAGTGGAAAATCTCCTCTTGCCCTACACGTTTCCTACATATCATTGTCTGTGCCCAAGAACTGTTAATCTCACATGCTCTGCAGGGACCCACAAAGGCGCGCCTTTTTGGGACTTAAAAATGTGTCCTTCCGGGAT
Associated Phenotype:
Not determined