Busch Lab

ZMP

specc1

Ensembl ID:
ENSDARG00000029480
ZFIN ID:
ZDB-GENE-060526-207
Description:
Novel protein similar to vertebrate spectrin domain with coiled-coils 1 (SPECC1) [Source:UniProtKB/T
Human Orthologue:
SPECC1
Human Description:
sperm antigen with calponin homology and coiled-coil domains 1 [Source:HGNC Symbol;Acc:30615]
Mouse Orthologue:
Specc1
Mouse Description:
sperm antigen with calponin homology and coiled-coil domains 1 Gene [Source:MGI Symbol;Acc:MGI:24423

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa13380 Nonsense Available for shipment Available now
sa13468 Nonsense Available for shipment Available now
sa1298 Nonsense Available for shipment Available now
sa20566 Essential Splice Site Available for shipment Available now
sa38521 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5333
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047143 Nonsense 127 1011 3 14
ENSDART00000137052 Nonsense 127 1035 3 14
Genomic Location (Zv9):
Chromosome 5 (position 65951237)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 62206145
GRCz11 5 62890871
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGAGAWCCCCCAAAGCATCTCCAGAGAACGTCTCTCAWCGCGCGATCAA[C/T]AGAAAAGCTCTACAGCCAAAAAGAYGGTCACCAGTTCCAGCGCCTCAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13380
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047143 Nonsense 556 1011 3 14
ENSDART00000137052 Nonsense 556 1035 3 14
ENSDART00000047143 Nonsense 556 1011 3 14
ENSDART00000137052 Nonsense 556 1035 3 14
Genomic Location (Zv9):
Chromosome 5 (position 65949950)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 62204858
GRCz11 5 62889584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAGTGACAACACTGAGCTGCAAAGTCTGCTCAAAGTGGCGCATGAAGAT[C/T]GAGACAAGCTGGAGATGACCTGCACAGAGCTACGACAAGAGCTGCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13468
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047143 Nonsense 556 1011 3 14
ENSDART00000137052 Nonsense 556 1035 3 14
ENSDART00000047143 Nonsense 556 1011 3 14
ENSDART00000137052 Nonsense 556 1035 3 14
Genomic Location (Zv9):
Chromosome 5 (position 65949950)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 62204858
GRCz11 5 62889584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAGTGACAACACTGAGCTGCAAAGTCTGCTCAAAGTGGCGCATGAAGAT[C/T]GAGACAAGCTGGAGATGACCTGCACAGAGCTACGACAAGAGCTGCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1298
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047143 None None 1011 None 14
ENSDART00000137052 Nonsense 655 1035 4 14
Genomic Location (Zv9):
Chromosome 5 (position 65946035)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 62200943
GRCz11 5 62885669
KASP Assay ID:
554-1213.1 (used for ordering genotyping assays)
KASP Sequence:
TGGACCTGGAGAGTATGATTATTATCTSTCTGTCTCTGGCTSTCCGTATA[C/T]AACACTGYCAAATGATCATGATCCCTGCGGCGTGTGTGTTTAACTGCTCT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa20566
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047143 Essential Splice Site 820 1011 8 14
ENSDART00000137052 Essential Splice Site 844 1035 8 14
Genomic Location (Zv9):
Chromosome 5 (position 65925590)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 62180498
GRCz11 5 62865224
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCATACCAGTCCGTACAGCTCCCGCTGCTGCCGTCTCACCCATTCAGG[T/C]ACTGCGAATCTCAAAATACACCAGGAGTTTATATGGAGAATGCCATCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38521
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047143 Nonsense 995 1011 14 14
ENSDART00000137052 Nonsense 1019 1035 14 14
Genomic Location (Zv9):
Chromosome 5 (position 65867892)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 62122800
GRCz11 5 62807526
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTCTTTGTAGGACTTCGAGGAATTGATGCGCACCGATCGACCCGACT[G/A]GCAAAGCGTCATGCAATACGTGTCTCAGATTTACAAATACTTCGAGACTT
Associated Phenotype:
Not determined