Busch Lab

ZMP

sort1a

Ensembl ID:
ENSDARG00000029402
ZFIN ID:
ZDB-GENE-040426-2329
Description:
Sortilin [Source:UniProtKB/Swiss-Prot;Acc:Q6NUT7]
Human Orthologue:
SORT1
Human Description:
sortilin 1 [Source:HGNC Symbol;Acc:11186]
Mouse Orthologue:
Sort1
Mouse Description:
sortilin 1 Gene [Source:MGI Symbol;Acc:MGI:1338015]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa41887 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41887
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020187 Nonsense 7 814 2 21
ENSDART00000146093 Nonsense 7 814 1 20

The following transcripts of ENSDARG00000029402 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 37181665)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36078893
GRCz11 11 36340876
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATTTTTTTGTGCACATTAAACGGGAACCATGAGCACCGTGTTGTGCTG[T/A]GTTTTGGTGTTATTAATCTCAGTGGCTCTTTGCATGGACTTTGAAGAGAG
Associated Phenotype:
Not determined