Busch Lab

ZMP

si:dkey-90m5.4

Ensembl ID:
ENSDARG00000029388
ZFIN ID:
ZDB-GENE-041014-250
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RHE5]
Human Orthologue:
LRG1
Human Description:
leucine-rich alpha-2-glycoprotein 1 [Source:HGNC Symbol;Acc:29480]
Mouse Orthologue:
Lrg1
Mouse Description:
leucine-rich alpha-2-glycoprotein 1 Gene [Source:MGI Symbol;Acc:MGI:1924155]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa44937 Nonsense Mutation detected in F1 DNA Not yet available
sa14432 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44937
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042820 Nonsense 200 327 3 3
Genomic Location (Zv9):
Chromosome 20 (position 23431659)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23545046
GRCz11 20 23444146
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACAAAATCGAAGAGCTTCCGGTAGGGTGTCTAGATGCTCACACTGCTT[T/A]GGAGAGGCTTTATTTGGACCAGAACAAAATCCAGACCTTGGACGTGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14432
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042820 Nonsense 204 327 3 3
Genomic Location (Zv9):
Chromosome 20 (position 23431672)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23545059
GRCz11 20 23444159
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGCTTCCGGTAGGGTGTCTAGATGCTCACACTGCTTTGGAGAGGCTTTA[T/A]TTGGACCAGAACAAAATCCAGACCTTGGACGTGAAAGCCTTTAGTGGCTY
Associated Phenotype:
Not determined