Busch Lab

ZMP

serpine2

Ensembl ID:
ENSDARG00000029353
ZFIN ID:
ZDB-GENE-040426-848
Description:
glia-derived nexin [Source:RefSeq peptide;Acc:NP_956478]
Human Orthologue:
SERPINE2
Human Description:
serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 [Sourc
Mouse Orthologue:
Serpine2
Mouse Description:
serine (or cysteine) peptidase inhibitor, clade E, member 2 Gene [Source:MGI Symbol;Acc:MGI:101780]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6397 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa993 Nonsense Available for shipment Available now
sa42621 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6397
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041677 Essential Splice Site None 395 1 9
Genomic Location (Zv9):
Chromosome 15 (position 42130846)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43402904
GRCz11 15 43283882
KASP Assay ID:
554-4615.1 (used for ordering genotyping assays)
KASP Sequence:
CACGAGCTCTCCATCTGCCTGAATWAAGAAGTTGAGGTGCTTGGTACAGG[T/C]TAGTGGAGAATATTATATGATTTTTGCATCKTATTTGGTTCCWTATTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa993
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041677 Nonsense 122 395 3 9
Genomic Location (Zv9):
Chromosome 15 (position 42115420)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43387478
GRCz11 15 43268456
KASP Assay ID:
554-0897.1 (used for ordering genotyping assays)
KASP Sequence:
ATATTGTGACCATCGCCAACGCWCTGTTCCCTAATGAGGGATTCAGCATG[A/T]AGGAGGACTTCCTGTCTGCCAACAGAGAGAACTTCCTGTGTGAGAGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42621
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041677 Nonsense 335 395 7 9
Genomic Location (Zv9):
Chromosome 15 (position 42095721)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43367779
GRCz11 15 43248757
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCTTTGGCATTTGTGTGTGAAACAGGTTCAGAGTCCATCTACGTGTCC[A/T]AAGCCCTTCAGAAAGCCAAGATAGAGGTCAATGAGGACGGAACCAAAGCC
Associated Phenotype:
Not determined