Busch Lab

ZMP

ssb

Ensembl ID:
ENSDARG00000029252
ZFIN ID:
ZDB-GENE-030131-223
Description:
Sjogren syndrome antigen B (autoantigen La) [Source:RefSeq peptide;Acc:NP_955841]
Human Orthologue:
SSB
Human Description:
Sjogren syndrome antigen B (autoantigen La) [Source:HGNC Symbol;Acc:11316]
Mouse Orthologue:
Ssb
Mouse Description:
Sjogren syndrome antigen B Gene [Source:MGI Symbol;Acc:MGI:98423]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20611 Nonsense Available for shipment Available now
sa13516 Nonsense Available for shipment Available now
sa20612 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20611
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041627 Nonsense 127 401 5 12
Genomic Location (Zv9):
Chromosome 6 (position 3532731)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3560226
GRCz11 6 3721046
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACAGAAAGGCTTTCCTCTTGAAACTACGCTGGATGATGTTAAAGAGTG[G/A]CTTGCTGATAAAGGCACATTTGAAAACATCTACCTGAGGAAAGGACCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13516
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041627 Nonsense 196 401 7 12
Genomic Location (Zv9):
Chromosome 6 (position 3534853)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3562348
GRCz11 6 3723168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCTGYCCATAGAGATGCCTACTTTACTAAAAAGATAGCYGAGAGGAAG[C/T]AGAACCGTGTGGAATCTAAAGCTAAAGCCAAATGGTAAAGCACAACACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20612
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041627 Nonsense 357 401 11 12
Genomic Location (Zv9):
Chromosome 6 (position 3537473)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3564968
GRCz11 6 3725788
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGAGGAGGCCGCAGAGACCGAGGAGGACGAGAACACACTCAGTTCAAG[G/T]GAAAGAAGACCAAGTTTGATAGCGATGAAGAGGGAGATGAAGGTAAAAGG
Associated Phenotype:
Not determined