Busch Lab

ZMP

syt9b

Ensembl ID:
ENSDARG00000029239
ZFIN ID:
ZDB-GENE-040822-6
Description:
synaptotagmin IX [Source:RefSeq peptide;Acc:NP_001003985]
Human Orthologue:
SYT9
Human Description:
synaptotagmin IX [Source:HGNC Symbol;Acc:19265]
Mouse Orthologue:
Syt9
Mouse Description:
synaptotagmin IX Gene [Source:MGI Symbol;Acc:MGI:1926373]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6802 Nonsense Mutation detected in F1 DNA Not yet available
sa38033 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6802
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049992 Nonsense 235 517 3 7
Genomic Location (Zv9):
Chromosome 25 (position 16217512)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15764056
GRCz11 25 15860456
KASP Assay ID:
554-5430.1 (used for ordering genotyping assays)
KASP Sequence:
GACGGTCGACGAGCGGACAGTTGCGGACGCCTGCACTTCATCATYAAATA[T/G]GACTGTGACTTGGAGYAGCTCATTGTCAAAATCCACAGGGCCCAAGATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4310
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049992 Nonsense 241 517 3 7
Genomic Location (Zv9):
Chromosome 25 (position 16217528)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15764072
GRCz11 25 15860472
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGTTGCGGACGCCTGCACTTCATCATYAAATATGACTGTGACTTGGAG[C/T]AGCTCATTGTCAAAATCCACAGGGCCCAAGATTTACCWGCCAAGGACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38033
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049992 Nonsense 385 517 4 7
Genomic Location (Zv9):
Chromosome 25 (position 16243759)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15790303
GRCz11 25 15886703
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCAACTGCGGGTCGTCTGACGATAACCATAATTAAAGCCAGAAATCTT[A/T]AAGCCATGGACATCACAGGAGCGTCTGGTAAGTCTCGTCACCTCTAAATG
Associated Phenotype:
Not determined