Busch Lab

ZMP

si:ch211-200p22.4

Ensembl ID:
ENSDARG00000029170
ZFIN ID:
ZDB-GENE-081104-61
Description:
Novel protein similar to phosphatidylinositol binding clathrin assembly protein (Picalm) [Source:Uni

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa14566 Nonsense Available for shipment Available now
sa26944 Essential Splice Site, Missense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26945
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028566 Nonsense 358 648 12 22
ENSDART00000146104 Nonsense 358 587 11 18

The following transcripts of ENSDARG00000029170 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 24947642)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23509394
GRCz11 7 23780551
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGTAGAACCAGCGTCTGAAGGAGATCGGCATGCAGACTCCCACCGCCT[C/A]GCCCAGCACACAATCTTTGGGCAGTGCCAACAACCACAACGCAGACGTGG
Long Flanking Sequence:
ATTCAGAGACTGACTGGCAGACTGCATCTAGAAGCCAGACATCAGATCAGACATGGTTCTAGGTTTGGCTGGTCAAATGTCAAGCAGTTTTGCTCAAGTCACTAGCTTGGCTTGAAAAATGCATGATTTATTGACTTCTCTTGTTCAGTTCGTGTAGTTTGTTCAGTGTGTAGAACTTTCTGCTGCCTAGAAAATCATGTCTGACTATCTCTCTACTACATACACACACACACACACACTCTGCAGGTCTGAGCTGTAGCTGACTGGCACTTGAGCTGCCTGAGTGGCTGTAATCTGTCTGATTTCACAGAGCTCAGCTGAAGGAAATGCTCTGTTCTGTCCTGCTCTCCAATGACCATCGGAGAGGAGGAAGGAGCTGAACAACCCAGTCTTTACATGCTTCACATTCTCTAAATGTTTTTTCTTCTTCATTTTCTCGTGTTGTGTGTTTGGGTAGAACCAGCGTCTGAAGGAGATCGGCATGCAGACTCCCACCGCCT[C/A]GCCCAGCACACAATCTTTGGGCAGTGCCAACAACCACAACGCAGACGTGGACCTGTTCACCAACACCACAAGCCCACCATCAATCAACAGGTCATTAACACACTGTACATGGCTGCAATACATATTATAACAAACAGTAATACAAAACACCTACTTATTACTACACCATATAATGCACAGGGTTAATACATACTTGAGTTTTAGGGTTAATTTACAGTGGTGTAATGAATTACCATTATTCAAGTTACTGTTATTTAGTAGTTTTTATTGTAACAAGTTGTTTTTATAAATGTGTGCTTTTATTTTAGTGCTGTGTTGGTAGTTTTGCAGCACTATTTTCTTTTAACTTACAGTAACTACTGTACTTTGCTTCTTTGTTTGTTTCTTTGTTTGTGGTGATTGGCTGAGTAGATTAATCAGTTCCTTGATTCTCGTCCAATTAACTTGTGCCTAGAAAAATCAACTCCAGACTAGGACTGTGTGATTTGGGGAAAATATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14566
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028566 Nonsense 622 648 22 22
ENSDART00000146104 Nonsense 561 587 17 18

The following transcripts of ENSDARG00000029170 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 24926205)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23487957
GRCz11 7 23759114
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGTTCCTCCTCAGCTGGGACAGATGGGAGGGGTTCCAGTCATGACCCAA[C/T]AACCCATGTTGTACAACCAGCCWGTTCTCAGACCCACTAACCCTTTCACA
Long Flanking Sequence:
ATCAGTTATTTATATATTTTCTTGCTCTAGTGTTGTGCAGTGTTGCATATACTGAGTGGACCAACCCACACATCTGTGCAGGCGAATTTACGTCCACCTGCCCTATAATTGTTGGAAATGAGTGTAATTAAAGATGATCTTTAAATGAAGCAAACATGATTAGTGAACCCAGTGGTGTTGAATTAGTACAGGAGTGTTTGATCAGAGTCTCATTGTTCACTTGATCAGTGCAGGGTTGTTTGATCAGTCAGCGTGACGAGGGTTGATTTTGTTGTGTGTTTTTTTTTTTTCTTTGCAGGCTCCTGCTCCCATGGCGTTTCCCATGACAACACCTCAAGTGCCTGTGTATGGAATGGTGAGCTTACAGTCACTACATGAATGTTGTGTACTCGAATTGCATAGTCAATAGCACCTCATAAAAAGACTGACTGTGGTTTTTCCAACGGGTTTAGGTTCCTCCTCAGCTGGGACAGATGGGAGGGGTTCCAGTCATGACCCAA[C/T]AACCCATGTTGTACAACCAGCCTGTTCTCAGACCCACTAACCCTTTCACACCCATCCCTGGAGCCCAGGTACTCATACAAACACACACCACCTGTGTCACACTCAAATACACTATGCTACATTATTTAATCTATTACTTAACAGTCTGAAAACGATGTAATATTTTAATTAAATGTGTTGCTGTCATGTTCCACATAAAAACATACTATAGTAATTTATAGTAAATAATATATATTTTTACCAGGCTTTTGTAAAGTTATATTATAGTATTTATGACACAGTTAATACAATGCTGATGCCTTCATTAACAGTAAACTGATAAACTGTAATAAGTAGTGTAGTATACTTTAGTTTTTACTACAATAGTAAAATATACCCTATAGTTGTAGAAAACTACATAGCAACCATTTTACCATAGAAACTGTAAAATTACTACAACAGATTAATTCAAGGATTTTATTATAGTATTGTTCAATAACACTATTGTATTTACTTTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26944
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028566 Missense 645 648 22 22
ENSDART00000146104 Essential Splice Site 583 587 None 18

The following transcripts of ENSDARG00000029170 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 24926135)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23487887
GRCz11 7 23759044
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTGTTCTCAGACCCACTAACCCTTTCACACCCATCCCTGGAGCCCAGG[T/C]ACTCATACAAACACACACCACCTGTGTCACACTCAAATACACTATGCTAC
Long Flanking Sequence:
CATCTGTGCAGGCGAATTTACGTCCACCTGCCCTATAATTGTTGGAAATGAGTGTAATTAAAGATGATCTTTAAATGAAGCAAACATGATTAGTGAACCCAGTGGTGTTGAATTAGTACAGGAGTGTTTGATCAGAGTCTCATTGTTCACTTGATCAGTGCAGGGTTGTTTGATCAGTCAGCGTGACGAGGGTTGATTTTGTTGTGTGTTTTTTTTTTTTCTTTGCAGGCTCCTGCTCCCATGGCGTTTCCCATGACAACACCTCAAGTGCCTGTGTATGGAATGGTGAGCTTACAGTCACTACATGAATGTTGTGTACTCGAATTGCATAGTCAATAGCACCTCATAAAAAGACTGACTGTGGTTTTTCCAACGGGTTTAGGTTCCTCCTCAGCTGGGACAGATGGGAGGGGTTCCAGTCATGACCCAACAACCCATGTTGTACAACCAGCCTGTTCTCAGACCCACTAACCCTTTCACACCCATCCCTGGAGCCCAGG[T/C]ACTCATACAAACACACACCACCTGTGTCACACTCAAATACACTATGCTACATTATTTAATCTATTACTTAACAGTCTGAAAACGATGTAATATTTTAATTAAATGTGTTGCTGTCATGTTCCACATAAAAACATACTATAGTAATTTATAGTAAATAATATATATTTTTACCAGGCTTTTGTAAAGTTATATTATAGTATTTATGACACAGTTAATACAATGCTGATGCCTTCATTAACAGTAAACTGATAAACTGTAATAAGTAGTGTAGTATACTTTAGTTTTTACTACAATAGTAAAATATACCCTATAGTTGTAGAAAACTACATAGCAACCATTTTACCATAGAAACTGTAAAATTACTACAACAGATTAATTCAAGGATTTTATTATAGTATTGTTCAATAACACTATTGTATTTACTTTAAATTACTATAATATTTTTTCGTTTGGGTTCCCTAAGTAGTTAATGTATGTAACATATTTAATTATGTTAATAA
Associated Phenotype:
Not determined