Busch Lab

ZMP

si:ch73-60e21.3

Ensembl ID:
ENSDARG00000029146
ZFIN ID:
ZDB-GENE-030131-7126
Description:
LOC565797 protein [Source:UniProtKB/TrEMBL;Acc:A5PLF1]
Human Orthologue:
LRP1
Human Description:
low density lipoprotein receptor-related protein 1 [Source:HGNC Symbol;Acc:6692]
Mouse Orthologue:
Lrp1
Mouse Description:
low density lipoprotein receptor-related protein 1 Gene [Source:MGI Symbol;Acc:MGI:96828]

Alleles

There are 15 alleles of this gene:

Allele Name Consequence Status Availability
sa166 Nonsense Confirmed mutation in F2 line Not yet available
sa200 Nonsense Confirmed mutation in F2 line Not yet available
sa30741 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37718 Nonsense Mutation detected in F1 DNA Not yet available
sa24342 Nonsense Available for shipment Available now
sa24341 Nonsense Available for shipment Available now
sa12511 Nonsense Available for shipment Available now
sa14527 Essential Splice Site Available for shipment Available now
sa37717 Nonsense Mutation detected in F1 DNA Not yet available
sa43990 Nonsense Mutation detected in F1 DNA Not yet available
sa18116 Essential Splice Site Available for shipment Available now
sa37716 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa166
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 296 4549 7 89
Genomic Location (Zv9):
Chromosome 23 (position 25854410)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25640530
GRCz11 23 25567071
KASP Assay ID:
554-0144.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACTTCTCTTTCTTTGTCTTCTAGATATGGAGCAGATGGCCATTGACTG[G/A]TTGACCGGAAACTTCTACTTTGTGGATAATGTGGATGACCGCATATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa200
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 441 4549 9 89
Genomic Location (Zv9):
Chromosome 23 (position 25850770)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25636890
GRCz11 23 25563431
KASP Assay ID:
554-0150.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTGTTTGAGAACTATCTGTATGCCACCAACTCTGACAACGCCAACATG[C/T]AACCCAAAACCAGCGTCATCAGAGTCAACCGATTCAACAGCTCTGACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30741
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Essential Splice Site 528 4549 10 89
Genomic Location (Zv9):
Chromosome 23 (position 25849888)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25636008
GRCz11 23 25562549
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTGCCGCTCTGGCTTTAGCCTTGGCAGTGATGGAAAGTCCTGCAAGAG[T/C]GAGTAAAATGTCATTCTGTCCACCCTCAATTAGTTCCAAACACCATAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37718
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 530 4549 11 89
Genomic Location (Zv9):
Chromosome 23 (position 25848297)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25634417
GRCz11 23 25560958
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTATTTTATTTTTCCATTTATACTTTGTTATATATCCTATACAGAACCA[G/T]AGCATGAGCTGTTCCTGATCTATGGTAAAGGCCGGCCTGGAGTCATCCGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3252
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 870 4549 16 89
Genomic Location (Zv9):
Chromosome 23 (position 25841581)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25627701
GRCz11 23 25554242
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCCTCCTCAGTGCCAGCCTGGAGAGTTTGCCTGTAAGAATAACCGCTG[T/A]ATTCAAGAGCGCTGGAAGTGTGATGGAGACAACGACTGTCTGGACAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24342
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 1072 4549 21 89
Genomic Location (Zv9):
Chromosome 23 (position 25829593)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25615713
GRCz11 23 25542254
KASP Assay ID:
2261-7817.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTGCAGCCACGCGGCCTCCCGGCGGTTGCCACACGGATGAGTTC[C/T]AATGCCGGATGGATGGTTTGTGTATTCCCATGCGATGGCGCTGTGATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24341
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 1500 4549 27 89
Genomic Location (Zv9):
Chromosome 23 (position 25819558)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25605678
GRCz11 23 25532219
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCTTTCGCCGTCACCCTGTATGGAGGAGAAGTGTACTGGACAGACTGG[C/T]GAACCAACACTCTGGCGAGGGCCAACAAGTGGACGGGACACAACGTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12511
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 1605 4549 29 89
Genomic Location (Zv9):
Chromosome 23 (position 25812704)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25598824
GRCz11 23 25525365
KASP Assay ID:
2261-7814.1 (used for ordering genotyping assays)
KASP Sequence:
CTTTAYGCTCGTCAGATTGAGATCAGAGGGGTTGACATTGATAATCCCTA[T/G]TACAACTACATCATCTCCTTCACTGTCCCYGACATTGACAATGTGACTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8015
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 1629 4549 29 89
Genomic Location (Zv9):
Chromosome 23 (position 25812634)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25598754
GRCz11 23 25525295
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACTGTCCCYGACATTGACAATGTGACTGTGGTGGATTATGATGCTCTG[G/T]AGCACCGMATCTACTGGTCYGATGTTCGCACGCAGACCATCAAAAGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14527
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Essential Splice Site 1751 4549 31 89
Genomic Location (Zv9):
Chromosome 23 (position 25809998)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25596118
GRCz11 23 25522659
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATGGCACCAACCACACACTGCTGTTCACCAAKCAGAAAGGCCCAGTTGG[T/C]GAGTGAGCTGTCTTACATACCTTTTGTTTGCCCAAAGCTAAAAGATGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37717
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 2033 4549 38 89
Genomic Location (Zv9):
Chromosome 23 (position 25803153)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25589273
GRCz11 23 25515814
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGACTGTTTGTGTGTCCAGGTATCTGTTTTGGACAGAGTGGGGTCAGTA[T/A]CCACGAATTGAAAGATCTCGCCTGGACGGTTCTGAGAGAGTAGTTCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43990
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 2704 4549 50 89
Genomic Location (Zv9):
Chromosome 23 (position 25788481)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25574601
GRCz11 23 25501142
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCCCGCAGAAAAAAGGCAACAGAAATGTTCAGAGAACAACTTTGCGTG[T/A]CCGAGCGGGCGCTGCATTCCCATGAGCTGGACCTGTGACAAAGAGAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18116
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Essential Splice Site 2732 4549 51 89
Genomic Location (Zv9):
Chromosome 23 (position 25787020)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25573140
GRCz11 23 25499681
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAATTCGACCTAAATTGTTTTGACAGTATGTTTTGCATTTGTTTTTTTA[G/A]AAAAGTTTTTCCAGTTCTGTGCATCTAATCAGTTTGAATGTGGAAACCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa439
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 3138 4549 59 89
Genomic Location (Zv9):
Chromosome 23 (position 25777215)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25563335
GRCz11 23 25489876
KASP Assay ID:
554-0291.1 (used for ordering genotyping assays)
KASP Sequence:
TGTGATAAAGGCAGAGACACTATTGAGGTGTCCAAGCTGAACGGAGCTTA[C/A]AGAAGTGTGCTGGTCAACAGTGGCCTGCGGGAACCTAGAGCTGTGGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37716
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 4513 4549 89 89
Genomic Location (Zv9):
Chromosome 23 (position 25740415)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25526535
GRCz11 23 25453076
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTATATTGTTTATCTCTCTCCCAGCCCACAAACTTCACAAACCCCGTGTA[C/A]GCCACGCTCTACATGGGTGCACATAACAGCCGTAACTCTCTGGCCAGCAC
Associated Phenotype:
Not determined