Busch Lab

ZMP

tubgcp3

Ensembl ID:
ENSDARG00000029133
ZFIN ID:
ZDB-GENE-030616-538
Description:
gamma-tubulin complex component 3 [Source:RefSeq peptide;Acc:NP_001004513]
Human Orthologue:
TUBGCP3
Human Description:
tubulin, gamma complex associated protein 3 [Source:HGNC Symbol;Acc:18598]
Mouse Orthologue:
Tubgcp3
Mouse Description:
tubulin, gamma complex associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:2183752]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3339
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042064 Nonsense 887 909 22 22
ENSDART00000143228 Nonsense 877 899 22 22
Genomic Location (Zv9):
Chromosome 1 (position 46946240)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45757901
GRCz11 1 46449133
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACGAGAGTCTCCAGTTCCTCAGTTTTCGTCTGGATTTCAATGAACATTA[C/A]AAGGCCCGTGACCCCCGCCTGCGGCCCTCGCTCGGGGCCACCAGAGGCAG
Associated Phenotype:
Not determined