Busch Lab

ZMP

Q6NW67_DANRE

Ensembl ID:
ENSDARG00000029117
Description:
LOC407678 protein [Source:UniProtKB/TrEMBL;Acc:Q6NW67]
Human Orthologue:
UNCX
Human Description:
UNC homeobox [Source:HGNC Symbol;Acc:33194]
Mouse Orthologue:
Uncx
Mouse Description:
UNC homeobox Gene [Source:MGI Symbol;Acc:MGI:108013]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa33291 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33291
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049365 Essential Splice Site 143 271 3 3
Genomic Location (Zv9):
Chromosome 3 (position 43523914)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42385566
GRCz11 3 43091581
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGAAACCAGCATAAACTTCACAATGAGTAAAAAACCTCCTGTTCTACC[A/T]GGTGTGGTTCCAGAACCGTCGGGCTAAAATGCGTCGTCAGCTGAAGCTCC
Associated Phenotype:
Not determined