Busch Lab

ZMP

chchd1

Ensembl ID:
ENSDARG00000029100
ZFIN ID:
ZDB-GENE-060810-176
Description:
coiled-coil-helix-coiled-coil-helix domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_00107
Human Orthologue:
CHCHD1
Human Description:
coiled-coil-helix-coiled-coil-helix domain containing 1 [Source:HGNC Symbol;Acc:23518]
Mouse Orthologue:
Chchd1
Mouse Description:
coiled-coil-helix-coiled-coil-helix domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913371]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6294 Nonsense Mutation detected in F1 DNA Not yet available
sa28096 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6294
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100941 Nonsense 78 113 2 3
Genomic Location (Zv9):
Chromosome 13 (position 21911169)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21640507
GRCz11 13 21770957
KASP Assay ID:
554-5325.1 (used for ordering genotyping assays)
KASP Sequence:
GACTTTAACAATGCATTCTGCCCTCAAGAAGTCACCGCTTTCTACACATG[T/A]GTCGAAAAGGTACTGCAGAYAGCAACTCACTSTCCTCRGGATATCCTCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28095
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100941 Nonsense 93 113 3 3
Genomic Location (Zv9):
Chromosome 13 (position 21915655)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21644993
GRCz11 13 21775443
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTTCACATTCTACAGGCGAAGATGAGGAACCAAGGAAGGAAGGCAGGT[C/T]GACTTTTGCCTGAGGAAGTCAACACCTTATTGAAACGATTTCCCAACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28096
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100941 Nonsense 105 113 3 3
Genomic Location (Zv9):
Chromosome 13 (position 21915691)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21645029
GRCz11 13 21775479
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGGAAGGCAGGTCGACTTTTGCCTGAGGAAGTCAACACCTTATTGAAA[C/T]GATTTCCCAACCAGGGAAGTCTGATCTAAAAGTGCAGTTTCATAGATTAA
Associated Phenotype:
Not determined