Busch Lab

ZMP

si:dkey-19f23.3

Ensembl ID:
ENSDARG00000029057
ZFIN ID:
ZDB-GENE-060503-338
Description:
transmembrane 6 superfamily member 1-like [Source:RefSeq peptide;Acc:NP_001074130]
Human Orthologues:
TM6SF1, TM6SF2
Human Descriptions:
transmembrane 6 superfamily member 1 [Source:HGNC Symbol;Acc:11860]
transmembrane 6 superfamily member 2 [Source:HGNC Symbol;Acc:11861]
Mouse Orthologues:
Tm6sf1, Tm6sf2
Mouse Descriptions:
transmembrane 6 superfamily member 1 Gene [Source:MGI Symbol;Acc:MGI:1933209]
transmembrane 6 superfamily member 2 Gene [Source:MGI Symbol;Acc:MGI:1933210]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa19290 Nonsense Mutation detected in F1 DNA Not yet available
sa11951 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa43809
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040601 Essential Splice Site 158 374 6 11
ENSDART00000145260 Essential Splice Site 158 321 6 11
Genomic Location (Zv9):
Chromosome 22 (position 18027117)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17778052
GRCz11 22 17803030
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGATCGCTGTGCGCCAACATGATTGTGTTTGTACCTGGAATCGTGGTTG[G/A]TGAGTCAACGTTAAACATCAAAAATGTTGCTGAATATTATAGACGTTTCC
Long Flanking Sequence:
TGTTATTTTGACACTCATGTTATTTAGCAACGTTTACATAATGTTTAACTGTATTTATAAACTGCTTACTAATGTCTATTAATATATATTTAATGCTGAACAAATAACAAATTAACTACTGCATAATAAATATTTCATAGTGTGCAGTTATTTGAGATGGATGTTTCTAAATTAGTCCGTAACAAAAGGTTAGTATACACTCAGTATTCTAGTTAGAAATGAAAAATATTTTTTATTATTATATGATTAATATAAGCCAACATGCCTGTATTAGATGAGACCAACAAAAAATTAATTACATTGGTAAGAATTGGTTCCATAAAAAATAAGGTTATGAATCTGGCAAGCATAACTACATGCTGCGATGTTTAAAAAAAGGAGTGGATGTTCCTAAATCAGCGTCTCCTATCATCCTAGACAACAATACCGCACATTGGGGCTGTTTTGGGCTGGATCGCTGTGCGCCAACATGATTGTGTTTGTACCTGGAATCGTGGTTG[G/A]TGAGTCAACGTTAAACATCAAAAATGTTGCTGAATATTATAGACGTTTCCTTCAAACACATTTTATATGCAGGTAAATATGGCTCCGAGATACGTCCTGCCTTTTGGCTCAACATGCCCTTTTTGTTGGTGCCAATATGGGGAGCTGTGTCTTTTTTCTCTAGGCCCAGAGATATGCGTCTTGTGGGTGCGGACAAGGTAAAACACCACATGTTAATCAATGGTTAATGAGAATTAGAAACATTCGATCAATAATGTTTGTATTCATCAGGCTGAACGCGAGCAGAAAAAGGCTTTAATATGGCGCCCTCTGGATCTGCTTTTTGTGGTATATCTACTAGCTGCCATGGGATTTACTATCTTTAGAGGACTGGTATGTTGGTGGTAAATATGTCTGATCTGATCATAAGTGGTTGTAAACTGTTTCTATTAACATATATTGTAATGCAGTGTTTCTCAACCATGTTTCTGGAGGACTACCAGCTCTGCACATTTTCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19290
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040601 Nonsense 251 374 9 11
ENSDART00000145260 Nonsense 251 321 9 11
ENSDART00000040601 Nonsense 251 374 9 11
ENSDART00000145260 Nonsense 251 321 9 11
Genomic Location (Zv9):
Chromosome 22 (position 18031801)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17782736
GRCz11 22 17807714
KASP Assay ID:
2261-6710.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGTCCTGGATTGCCCGCTGGAAATCCTCAACAAATATGTGACCGAGTA[T/A]GAACCGTATCTAAAGGATCCCGTGGGCTTCCCCAAAGTTATGGTGAGATA
Long Flanking Sequence:
ATATAGAAATAACAAACTTTAATCCTTTATTAGTGAAAATACTAGCGGTCTAAAACTTTTAGGCTGTATAGTACTGTATATCCCAGACATCTGCACAAACTTCCTCTGTAACAAAGCACAGACACATTCGAGGATATATGTCAACACTTGAATGTGCGCAATATACTGACACTGAAAGGAAGTAATGTTTGAATAAAGCCTTTATTTTTTTTAGTGTGCACTCTTGTAGCTTCATAATATTCAGATTAAACCACTGAAGGTCTGTTATGAGGATGTTTTTTGGTATCAGGTCTCAGGTGTTAGAATGACATAAGGGTGAGTAACATAATTTTCATTTTTGAGTGAACTAACCCTTTAAACATGGTGCCTGTATTATGTTTTGTGAAAATAATGCCTACAGTTCAACAAAAAATAATTGCCACAACAAATTTCCCATCTCTATCCACACAGGCAGTCCTGGATTGCCCGCTGGAAATCCTCAACAAATATGTGACCGAGTA[T/A]GAACCGTATCTAAAGGATCCCGTGGGCTTCCCCAAAGTTATGGTGAGATACTCTGACATTCAGCTTATGGCGGCCCTCGAGCACACTTTGCTTCTTAACAGCCTTGGCTTTATAACATTAAGCTCCTCTAAATGACTGGTTTTTCTCATCATTAGCACTCAATAAGGTTGTCACCTTGAGTAGTCCAAGAATATCTCTACTGTCTCGACCGACCGCGCGGGTTTGGAAGGTGATGTTTTCGGTTTAGATTGGGGTTTCACTTCGGTCAATAGGTTATCAAAAGTCCTTGTTCTAGCTAGAGCCCAGGCACAATGGAGGCCCATCGATTAGCTAGGAGATGTGCTGCGAGTACTTGATAAGCTAATCCTACCCATGAGTCCTGGCTGAAAACCTCCCGTCAGCTCAAACAAGGGGACGTGACGGAGAGATTGTGACATGGGTGGTAATGTGTTTGATAAGGAATGAGGGAGCAGAAACACGTATGTTTGTACTGAAGACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11951
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040601 Nonsense 251 374 9 11
ENSDART00000145260 Nonsense 251 321 9 11
ENSDART00000040601 Nonsense 251 374 9 11
ENSDART00000145260 Nonsense 251 321 9 11
Genomic Location (Zv9):
Chromosome 22 (position 18031801)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17782736
GRCz11 22 17807714
KASP Assay ID:
2261-6710.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGTCCTGGATTGCCCGCTGGAAATCCTCAACAAATATGTGACYGAGTA[T/A]GAACCGTATCTAAAGGATCCCGTGGGCTTCCCCAAAGTTATGGTGAGATA
Long Flanking Sequence:
ATATAGAAATAACAAACTTTAATCCTTTATTAGTGAAAATACTAGCGGTCTAAAACTTTTAGGCTGTATAGTACTGTATATCCCAGACATCTGCACAAACTTCCTCTGTAACAAAGCACAGACACATTCGAGGATATATGTCAACACTTGAATGTGCGCAATATACTGACACTGAAAGGAAGTAATGTTTGAATAAAGCCTTTATTTTTTTTAGTGTGCACTCTTGTAGCTTCATAATATTCAGATTAAACCACTGAAGGTCTGTTATGAGGATGTTTTTTGGTATCAGGTCTCAGGTGTTAGAATGACATAAGGGTGAGTAACATAATTTTCATTTTTGAGTGAACTAACCCTTTAAACATGGTGCCTGTATTATGTTTTGTGAAAATAATGCCTACAGTTCAACAAAAAATAATTGCCACAACAAATTTCCCATCTCTATCCACACAGGCAGTCCTGGATTGCCCGCTGGAAATCCTCAACAAATATGTGACCGAGTA[T/A]GAACCGTATCTAAAGGATCCCGTGGGCTTCCCCAAAGTTATGGTGAGATACTCTGACATTCAGCTTATGGCGGCCCTCGAGCACACTTTGCTTCTTAACAGCCTTGGCTTTATAACATTAAGCTCCTCTAAATGACTGGTTTTTCTCATCATTAGCACTCAATAAGGTTGTCACCTTGAGTAGTCCAAGAATATCTCTACTGTCTCGACCGACCGCGCGGGTTTGGAAGGTGATGTTTTCGGTTTAGATTGGGGTTTCACTTCGGTCAATAGGTTATCAAAAGTCCTTGTTCTAGCTAGAGCCCAGGCACAATGGAGGCCCATCGATTAGCTAGGAGATGTGCTGCGAGTACTTGATAAGCTAATCCTACCCATGAGTCCTGGCTGAAAACCTCCCGTCAGCTCAAACAAGGGGACGTGACGGAGAGATTGTGACATGGGTGGTAATGTGTTTGATAAGGAATGAGGGAGCAGAAACACGTATGTTTGTACTGAAGACCG
Associated Phenotype:
Not determined