Busch Lab

ZMP

si:ch211-137i24.2

Ensembl ID:
ENSDARG00000029039
ZFIN ID:
ZDB-GENE-060526-38
Description:
Novel protein containing a DHHC zinc finger domain [Source:UniProtKB/TrEMBL;Acc:A2BEM9]
Human Orthologue:
ZDHHC23
Human Description:
zinc finger, DHHC-type containing 23 [Source:HGNC Symbol;Acc:28654]
Mouse Orthologue:
Zdhhc23
Mouse Description:
zinc finger, DHHC domain containing 23 Gene [Source:MGI Symbol;Acc:MGI:2685625]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa20407 Essential Splice Site Available for shipment Available now
sa40419 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31434 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20407
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041905 Essential Splice Site 44 407 1 4
ENSDART00000143563 None None 363 None 3
Genomic Location (Zv9):
Chromosome 5 (position 25951628)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23778893
GRCz11 5 24282693
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGAGTACTGCTGCTGTGACTGTGAAGAACTCGACGATGCCTGCGAAAGG[T/C]TAGAAGTCAACTGTTTTAAAGGAACCTACATCTTTTCATACAAGCTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40419
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041905 Essential Splice Site 44 407 2 4
ENSDART00000143563 None None 363 None 3
Genomic Location (Zv9):
Chromosome 5 (position 25956858)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23784123
GRCz11 5 24287923
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAATTGTATTGAATTTGTATTTTTTCTGTTTTTCCTCTATTTTTATTTA[T/A]AAGGTTACTCAGAGGAGAGCCAGACAAGCCAGACGTGTTTTCGCGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31434
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041905 Nonsense 90 407 2 4
ENSDART00000143563 Nonsense 46 363 1 3
Genomic Location (Zv9):
Chromosome 5 (position 25956996)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23784261
GRCz11 5 24288061
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCGTAGGACCTCTTCGACTGGAACTCTCTGTTTTACCTCCCATGGTTT[T/A]AATCCCTGGCCTGTTGCGAGTCGCAGCGATTAATTGCTTGTTGGGAGTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2240
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041905 Nonsense 221 407 2 4
ENSDART00000143563 Nonsense 177 363 1 3
Genomic Location (Zv9):
Chromosome 5 (position 25957389)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23784654
GRCz11 5 24288454
KASP Assay ID:
554-3131.1 (used for ordering genotyping assays)
KASP Sequence:
RAGCACAAACTTAACATTAGACACAGACCTGCGTAATGGAGTCAGCCATT[T/G]AAAGGGAGAGAAGGATGTGAAGAAGAAGTGTCCTGTGTGCCAACTGGTGC
Associated Phenotype:
Not determined