Busch Lab

ZMP

epb41

Ensembl ID:
ENSDARG00000029019
ZFIN ID:
ZDB-GENE-030130-1
Description:
erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) [Source:RefSeq peptide;Acc:NP_7
Human Orthologue:
EPB41
Human Description:
erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) [Source:HGNC Symbol;Acc:3377]
Mouse Orthologue:
Epb4.1
Mouse Description:
erythrocyte protein band 4.1 Gene [Source:MGI Symbol;Acc:MGI:95401]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa42730 Nonsense Mutation detected in F1 DNA Not yet available
sa45577 Nonsense Mutation detected in F1 DNA Not yet available
sa36150 Nonsense Mutation detected in F1 DNA Not yet available
sa36151 Nonsense Mutation detected in F1 DNA Not yet available
sa15697 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4662
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039746 Essential Splice Site 167 1534 5 27

The following transcripts of ENSDARG00000029019 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 28702451)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26578225
GRCz11 16 26451667
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGAGTAAAGAGCTGGAGGAGAAAGTGATGGAGCTGCAYGCCACGTACAG[G/A]TATACTATTAAATAAACATACAAATGTCCTCTGACTTGTACACAAAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42730
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039746 Nonsense 215 1534 7 27

The following transcripts of ENSDARG00000029019 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 28705490)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26581264
GRCz11 16 26454706
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGGTGAAGATGTTATGCTTGGCGTGTGCTCCGAGGGACTGATTGTATA[T/A]GAAGATGGTGTAAAAACAAATTCCTTCTTCTGGCCTAGAGTGCTGAAAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28665
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039746 Nonsense 478 1534 12 27

The following transcripts of ENSDARG00000029019 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 28708593)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26584367
GRCz11 16 26457809
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGAGAACGAATACAGAGAGTGGTGATGACCAAAGAATGGACACAAACA[C/T]AAGACAATGGAGAGAAAAGAGTAGAGAGGGTGGAAAGACGTGTAATTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45577
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039746 Nonsense 820 1534 16 27

The following transcripts of ENSDARG00000029019 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 28719666)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26595440
GRCz11 16 26468882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGAAAAGAGGAGCGAGTGATTGAGGTGATGACGGTGAGCACTAGAGAA[C/T]AGATAACAGTACCAGAGACGAAGAGAATCAGCGTAACACAAATCCCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36150
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039746 Nonsense 1042 1534 19 27

The following transcripts of ENSDARG00000029019 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 28730052)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26605826
GRCz11 16 26479268
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGTTTTTCAGTGCAAGGTCCAGCTGTGTTTGTGGAGAGCAGAGAGCAA[C/T]AGATTGAGAGCAGAGTGAGAAAAGAGGAGCGAGTGATTAAGGTGATGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36151
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039746 Nonsense 1354 1534 22 27

The following transcripts of ENSDARG00000029019 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 28733888)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26609662
GRCz11 16 26483104
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGAGGAAAGAGCAGTGCAGCTGCAGACAGAAGTGGAGGATGACTGGTA[T/A]ATGCTAATGGGCATTACCCTCAAAGATTACAGTACGTATTATGGGAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15697
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039746 Nonsense 1407 1534 23 27

The following transcripts of ENSDARG00000029019 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 28734150)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26609924
GRCz11 16 26483366
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CYGCTGACTTCTACTCCAACCGCACAATCTGCGTCCATTACAAAAACWTA[T/A]AAGGAGAGGACGAAAGAYATACTGGACATCACAGTGGAGTCTGAGGTTAG
Associated Phenotype:
Not determined