Busch Lab

ZMP

calcr

Ensembl ID:
ENSDARG00000028845
ZFIN IDs:
ZDB-GENE-060503-420, ZDB-GENE-060503-420, ZDB-GENE-070424-193
Description:
Novel protein similar to vertebrate calcitonin receptor (CALCR) [Source:UniProtKB/TrEMBL;Acc:A5WVU8]
Human Orthologue:
CALCRL
Human Description:
calcitonin receptor-like [Source:HGNC Symbol;Acc:16709]
Mouse Orthologue:
Calcrl
Mouse Description:
calcitonin receptor-like Gene [Source:MGI Symbol;Acc:MGI:1926944]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa44922 Nonsense Mutation detected in F1 DNA Not yet available
sa32256 Essential Splice Site Available for shipment Available now
sa17942 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44922
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051943 Nonsense 94 598 3 15
ENSDART00000131471 Nonsense 79 583 2 14
Genomic Location (Zv9):
Chromosome 19 (position 41736591)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41188845
GRCz11 19 40775965
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGACGGTTTGCTTTGTTGGGATGAAACTCCAGCTGGAACCTTTGCCTCA[C/T]AAAACTGCCCCGATTACCCCAGCTTTGACCCCTTGGGTAAGAATCGCACG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29253
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051943 Essential Splice Site 141 598 5 15
ENSDART00000131471 Essential Splice Site 126 583 4 14
Genomic Location (Zv9):
Chromosome 19 (position 41731423)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41183677
GRCz11 19 40770797
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGATATGTTTAATGTGTATTCTCAAAACAAATGATGCTTTTTATCTTC[A/T]GACGTTACCAGTTCACGGCTTTTCAGAGACAGAGACGGAGCTGGATCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32256
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051943 Essential Splice Site 302 598 9 15
ENSDART00000131471 Essential Splice Site 287 583 8 14
Genomic Location (Zv9):
Chromosome 19 (position 41706976)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41159230
GRCz11 19 40746350
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCTCTGTCATGAATGATCAGCGAGCGATGTTTGTTTGTTTCTCATTCA[G/A]GAGTCTGAGCTGTCAGAGAATCACACTCCACAAGAACCTGTTCTGCTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17942
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051943 Essential Splice Site 416 598 12 15
ENSDART00000131471 Essential Splice Site 401 583 11 14
Genomic Location (Zv9):
Chromosome 19 (position 41689373)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41141627
GRCz11 19 40728747
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGTTTGGTGGACAGTACCTCTGATATGGGATTTATTATATTTTTCCACT[A/C]GCTGCTGGATGAGTGTGGAGACGCATCTGCTCTACGTGGTTCACGGCCCC
Associated Phenotype:
Not determined