Busch Lab

ZMP

si:dkey-283b15.4

Ensembl ID:
ENSDARG00000028800
ZFIN ID:
ZDB-GENE-100921-55
Human Orthologue:
CYTH2
Human Description:
cytohesin 2 [Source:HGNC Symbol;Acc:9502]
Mouse Orthologue:
Cyth2
Mouse Description:
cytohesin 2 Gene [Source:MGI Symbol;Acc:MGI:1334255]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa19129 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11018 Essential Splice Site Available for shipment Available now
sa5885 Nonsense Mutation detected in F1 DNA Not yet available
sa22743 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19129
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100848 Essential Splice Site 162 416 5 12
ENSDART00000140226 Essential Splice Site 162 416 5 12
ENSDART00000100848 Essential Splice Site 162 416 5 12
ENSDART00000140226 Essential Splice Site 162 416 5 12
Genomic Location (Zv9):
Chromosome 16 (position 6880071)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5724602
GRCz11 16 5624228
KASP Assay ID:
2260-9159.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTGGATCTTCACGAGTTCACAGATCTGAACTTGGTACAAGCACTTCGG[T/A]AAATCATTAATTCTTTATTGCATATCTTTATCCTAAACAATTGTATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11018
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100848 Essential Splice Site 162 416 5 12
ENSDART00000140226 Essential Splice Site 162 416 5 12
ENSDART00000100848 Essential Splice Site 162 416 5 12
ENSDART00000140226 Essential Splice Site 162 416 5 12
Genomic Location (Zv9):
Chromosome 16 (position 6880071)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5724602
GRCz11 16 5624228
KASP Assay ID:
2260-9159.1 (used for ordering genotyping assays)
KASP Sequence:
TTGTGGATCTTCACGAGTTCACAGATCTGAACTTGGTACAAGCACTTCGG[T/A]AAATCAKTAATTCTTTATTGCATATCTTTAWCCTAAACAATTGTATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5885
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100848 Nonsense 186 416 6 12
ENSDART00000140226 Nonsense 186 416 6 12
Genomic Location (Zv9):
Chromosome 16 (position 6880350)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5724881
GRCz11 16 5624507
KASP Assay ID:
554-3895.1 (used for ordering genotyping assays)
KASP Sequence:
GCTTGCCAGGYGAAGCTCAAAAAATCGACAGGATGATGGAGGCCTTCGCA[C/T]AGAGATACTGTCACTGCAATCCTGGAGTCTTCCAGAGCACAGGTNNCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22743
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100848 Nonsense 361 416 11 12
ENSDART00000140226 Nonsense 361 416 11 12
Genomic Location (Zv9):
Chromosome 16 (position 6889764)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5734295
GRCz11 16 5633921
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGAATAACCGCGGTCAGCTGATTAAAGCCTGTAAGACGGAGGCTGATGGT[C/T]GAGTGGTGGAGGGAAACCACATGGTGTACCGGATCTCTGCTCCCACCCCA
Associated Phenotype:
Not determined