Busch Lab

ZMP

si:dkey-24p1.6

Ensembl ID:
ENSDARG00000028784
ZFIN ID:
ZDB-GENE-060503-67
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LY87]
Human Orthologue:
SEL1L3
Human Description:
sel-1 suppressor of lin-12-like 3 (C. elegans) [Source:HGNC Symbol;Acc:29108]
Mouse Orthologue:
Sel1l3
Mouse Description:
sel-1 suppressor of lin-12-like 3 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1916941]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa42606 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22710 Nonsense Available for shipment Available now
sa22711 Essential Splice Site Available for shipment Available now
sa30685 Nonsense Mutation detected in F1 DNA Not yet available
sa24994 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa28520 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42606
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099375 Essential Splice Site 16 1028 1 23
ENSDART00000129941 None None 448 None 13
ENSDART00000142403 Essential Splice Site 16 279 1 5
Genomic Location (Zv9):
Chromosome 15 (position 36998022)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38398026
GRCz11 15 38299611
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATGAGGGATCTAAAGAGTTTATACTTGTGCTCATATGTCATTGTTTGT[G/T]TAAGTATATCCTACACATATCAGTTACCATGCTTAATGTTGTTTACATCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3937
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099375 Splice Site, Nonsense 223 1028 4 23
ENSDART00000129941 None None 448 None 13
ENSDART00000142403 Splice Site, Nonsense 223 279 4 5
Genomic Location (Zv9):
Chromosome 15 (position 37001053)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38401057
GRCz11 15 38302642
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAGTTTAATATGCAGTATAACCAAGCGAGTAACGGTTCTGGCTCTTCAG[G/A]TGTGCAGTTTCACTTTGGCTTTTGYTGGTGAAGCCRTGCAGTAACCGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22710
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099375 Nonsense 384 1028 8 23
ENSDART00000129941 None None 448 None 13
ENSDART00000142403 None None 279 None 5
Genomic Location (Zv9):
Chromosome 15 (position 37008297)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38408301
GRCz11 15 38309886
KASP Assay ID:
2260-8887.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTGAGATTCACCTTCCTCATGTATTATCAAAAGTCAATATAACCGGCT[G/A]GTTCCAGTCTTGTCAGAACTTCAGATCAGAACTTGAGCTCTTTTCCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22711
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099375 Essential Splice Site 670 1028 14 23
ENSDART00000129941 Essential Splice Site 90 448 4 13
ENSDART00000142403 None None 279 None 5
Genomic Location (Zv9):
Chromosome 15 (position 37015139)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38415143
GRCz11 15 38316728
KASP Assay ID:
2260-8888.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCTTGGAGGACAGTAAGCTTACTAAATATCACACTTGCTTCTGTTAAC[A/T]GGGTCAAGGAGTTCAGAAAGATGTTCGCAAAGCTGTTACGTTCCTTAAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28519
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099375 Nonsense 737 1028 15 23
ENSDART00000129941 Nonsense 157 448 5 13
ENSDART00000142403 None None 279 None 5
Genomic Location (Zv9):
Chromosome 15 (position 37017981)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38417985
GRCz11 15 38319570
KASP Assay ID:
2260-8889.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGCTAAAGGTCATGCAGACGCTGCCATGAATCTGGGCGTATTCCACT[C/A]ACAGGGTCTTTATCCTGGACAGCCTGCAGACCCGGTAAATACTTGCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30685
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099375 Nonsense 784 1028 16 23
ENSDART00000129941 Nonsense 204 448 6 13
ENSDART00000142403 None None 279 None 5
Genomic Location (Zv9):
Chromosome 15 (position 37021534)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38421538
GRCz11 15 38323123
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATTGAATTGGCTGATATCTGGATTCATGGACTCCCTGGTCAAGTTGCT[C/T]GACGTCCATCAGACGCTGTTCTGTATGTATCTCAAAATACTTGTTCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24994
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099375 Essential Splice Site 819 1028 17 23
ENSDART00000129941 Essential Splice Site 239 448 7 13
ENSDART00000142403 None None 279 None 5
Genomic Location (Zv9):
Chromosome 15 (position 37023942)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38423946
GRCz11 15 38325531
KASP Assay ID:
554-7694.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGAAGAGTCTTACGGAAAGGACTGAATGCTTATTTCAGAGGAAACTGG[T/C]AAACCTTTGTTTAAGCTGTACATGCAGTCTACTGTACTTGTATGTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28520
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099375 Essential Splice Site 878 1028 20 23
ENSDART00000129941 Essential Splice Site 298 448 10 13
ENSDART00000142403 None None 279 None 5
Genomic Location (Zv9):
Chromosome 15 (position 37026442)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38426446
GRCz11 15 38328031
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCTCCTGGAGCTCAGTCCTCCCTGTCTGCATGTGTTTGTTTCTCTCTC[A/C]GCTTTGATCCGGACAGGAGATCTGATCTATGGAGAAAACCAGCATTCTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3935
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099375 Nonsense 975 1028 22 23
ENSDART00000129941 Nonsense 395 448 12 13
ENSDART00000142403 None None 279 None 5
Genomic Location (Zv9):
Chromosome 15 (position 37027072)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38427076
GRCz11 15 38328661
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCACTGATGCATACTTGCCCTGCACACTGGCTCTRTTCAGCGCACACCTA[C/T]AGTCTTTACAACTAMATCAGGACATCGCTATAAAGGTTCGTCCATATATA
Associated Phenotype:
Not determined