Busch Lab

ZMP

si:ch211-71c16.7

Ensembl ID:
ENSDARG00000028780
ZFIN ID:
ZDB-GENE-091204-156
Human Orthologue:
GZMM
Human Description:
granzyme M (lymphocyte met-ase 1) [Source:HGNC Symbol;Acc:4712]
Mouse Orthologue:
Gzmm
Mouse Description:
granzyme M (lymphocyte met-ase 1) Gene [Source:MGI Symbol;Acc:MGI:99549]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa43620 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43620
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058489 Nonsense 35 257 2 5
Genomic Location (Zv9):
Chromosome 21 (position 18353292)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19488781
GRCz11 21 19525417
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTTCCAGTTTGCTCTGACGTATCAATTGTTGGAGGCAAAGATGTC[A/T]AAAAAGCTTTATCGTGGATGGTGTCCATTCAGGTAAACCAGAATCATAAA
Long Flanking Sequence:
GTTTACATTAAATAAACCTGCATGAAATCAAATTAAGTCCTACTCTCTTATATCAACACCACTAACAGTAAAAGTTACGACTTGTTGATTGACTCAGTGTGAACTTGTGAAAATGTGCAAAAACAGATGCATCACCTTGCATGCAAAACCCCCCACACAAACACACCTCCTGATTCTGCTCTGACCACAAAGATGACTAAGAAAGGGCAATTAAAAAGCGGTTATTTCCTCATTGCTCTCACACTTGATGTTAAAGGACATCTGAGAAAACACATTGATTTTTGGCTGAGAGGACGGTCCACTCAATGGATATTTGCAGAAATTTGATTGTGTTTCACTTCTTGGTGTTCACCTTTTTTAAAGTGACAGGTAATGATTGTTTTTTTGTCCCAGAGTTTGGTTGCAAACTTCATTAGTGTTCTTTTGTTCAACCTGTAACTGTCTTTAAAATCTCTCTTCCAGTTTGCTCTGACGTATCAATTGTTGGAGGCAAAGATGTC[A/T]AAAAAGCTTTATCGTGGATGGTGTCCATTCAGGTAAACCAGAATCATAAATGTGGAGGAATCCTGATTCACAAAGAGTGGGTTTTAACAGCGGCGCATTGCAAAGAGTAAGGAAACTACACTGAGTTTACACAAACTAAGCATATTATCATCTTTTTAGGAAAGAATGCCGTAAATATAAAAATCAGAACAAGTGTTAATCAGAAGCTAATTTAAGATAAATAAAGATAAAGTCAGATATTTAATTAAGTTTATTTTAATTTTAAGTTTTACGTAATTTTACTTTTACTAATGCAATTTAGGGTATACATTTAGTAATTTGACATACATTAGATGTAATAATATCCCTTTTCTTTGATTAATTTGTTAACAGATTAATATCTATTTTTAGGTTTGTTTGTTGACATGCTGGAAACTTTAAACAGAACTTGCTACACTGGGTTTTTTTTTATTGAAAAAGCTTCTTAGTAAAGAGCTCGGATCATTAAATGTGCTACTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29563
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058489 Essential Splice Site 201 257 4 5
Genomic Location (Zv9):
Chromosome 21 (position 18354844)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19490333
GRCz11 21 19526969
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGACATGCTGTGTGCAGGAAACACACAGCAGCACAGAGGAACCTGTTTG[G/A]TGGGTTTCACCCATACAGATGCTGATTTATGCTGTTTGCAAACATTTCTT
Long Flanking Sequence:
TTTTATTTCAGAGACTCCTATTCATCAGTGACGGTTCTCATAGGATCTCTATCTCTGAGTAAAGGCTCTCAGCGTATTGCCATCCACAATTACGAAATCCCTGAAACATTCAATAAAAAGACTAAAAAAGACGACATCATGCTCATTAGGGTAAGGATGAACAAAAATTTTTTGTCATTTATTCATAATTAACTCTTTTACTGCTTTTACACAACATGCATTTGAGCATCGCCATATCTTTGCAGCTAAGCAAAAAAGTTAAAGCCAAACCCTACAAAATCCCTAAAAAGGAAAAAGACGTCCAACCCGGAACAAAATGTGTTGTGAGAGGTTGGGGAACCACTGATTATAAAGGCAAGCAAGCTTCTGATAAACTGCAAATGTTGGAGGTGTTGGTGGTGGACAGAGTGCAGTGCAACCGCTACTATAACAGAAATCCTGTCATCACCAAAGACATGCTGTGTGCAGGAAACACACAGCAGCACAGAGGAACCTGTTTG[G/A]TGGGTTTCACCCATACAGATGCTGATTTATGCTGTTTGCAAACATTTCTTCACATGTCTGGAGGATGAAGATCTTGATTTGTTTTTCAGGGAGATTCTGGTGGACCTCTGGAGTGTGAGAAAAACCTGGTTGGAGTGCTTTCAGGCTCACACGGATGTGGGGATCCCAAAAAACCCACAGTGTACACGCTTCTGTCCAAAAGACATATCACCTGGATCAATAAAATACTGAAACAGCAATTCAACAGCACACGCTTTTAGGAAACCAAACTTTTCCAGCTTATATACAGTAGCCTGCACTTTCAGAAATAAAGGTACAAAAACTGTGACTGGGGTGTAGCTGTACCTTAGGGCTGCATCTAGACTTGTTAGCACCCTAGGCGAGATTATTATTCATTAAATACATAATATAATGCATCTTTTAAATAGTTATTCCATCTACGTAATTTTTTTTTCTGAAAATATGCTGTTCTTTTTTAAAAATGTTTGTGACTTTAAATT
Associated Phenotype:
Not determined