Busch Lab

ZMP

gdap1l1

Ensembl ID:
ENSDARG00000028628
ZFIN ID:
ZDB-GENE-080812-2
Description:
Novel protein similar to H.sapiens GDAP1L1, ganglioside-induced differentiation-associated protein 1
Human Orthologue:
GDAP1
Human Description:
ganglioside-induced differentiation-associated protein 1 [Source:HGNC Symbol;Acc:15968]
Mouse Orthologue:
Gdap1
Mouse Description:
ganglioside-induced differentiation-associated-protein 1 Gene [Source:MGI Symbol;Acc:MGI:1338002]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4237
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047082 Nonsense 360 367 6 6
Genomic Location (Zv9):
Chromosome 23 (position 35833885)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 35683538
GRCz11 23 35782341
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCATCCTTCCTAATGGGCTCTCTCGGAGGGATGGGCTATTTTGCCTATTG[G/A]TTTTTAAAAAAGAAATACATGTAGTGAATGTGCTCTTSTAGTGTTTTGTG
Long Flanking Sequence:
GTACATAGCGGCCTCTGGTGGATTCGCAAAAATAAAAACAACAATAACAAAAAACCTTCTGGCGTTCTCCAGAAATGTATATAGCTTTACGTTTTTAGAATAAGCCTGTACCTTTAGGAGCCACTGTATATGATTTAGCTTTTTCAAGAGCATCTACAGGCTGTCTTTTCTTCCTGCGCAGGTCAAAAGTGTGAATTATGGCTTTGTGGACCTACTTTTACACTAGCTGATATTTGTCTTGGAGCCACGTTGCACAGGCTCAAGTTCTTGGGACTCTCGAGGAAATATTGGGAGGATGGGAGCCGGCCAAACCTGCAGTCGTTTTTTGAGCGGGTGCAGAAGCGTTACGCCTTCCGCAAGGTATTGGGGGACATCCACACCACCCTGCTTTCGGCAGTTCTACCCAATGCTTTCCGAATGGTAAAAAAGAAGCCGCCATCCTTTTTCGGGGCATCCTTCCTAATGGGCTCTCTCGGAGGGATGGGCTATTTTGCCTATTG[G/A]TTTTTAAAAAAGAAATACATGTAGTGAATGTGCTCTTCTAGTGTTTTGTGTCTGTGTATCTGTGTGATGGTCGAACATTTTGGGTTACACTGTTTTACGAGAGCAGGAGCAACGAGACAAATATACAGAGATTAACACTATTACTTACCTGGGTGAACAATTAAATAAATATATAATGAGAACATTCCAAGACTAGGAATTCTTCTTAACAGCACCTTCTCTGGTAATGAATGCCTTCATTTATTTTCCTGTTTATGATTTACTGGTATATTTTTTTCATTTTGTGCTTGAATAGAGCACAAGTATGTTTTTTCGTTCTCTCCAGATTATAAACACTGCACATTCTGCCATTTACTGGTTGTTTTGATTATATAGATTATATAGCACAATGGCCAAGTAAACTTGAAGTAAGTTATGACTTTAAATCCCAAAATAATGTTTGTTAAAGTACACTAAATTCGTACACATCTATCTTTTGTACTATCTGCCACTGACTGCTT
Associated Phenotype:
Not determined