Busch Lab

ZMP

fbxw11a

Ensembl ID:
ENSDARG00000028543
ZFIN ID:
ZDB-GENE-030131-6305
Description:
F-box and WD-40 domain protein 11a [Source:RefSeq peptide;Acc:NP_958467]
Human Orthologue:
FBXW11
Human Description:
F-box and WD repeat domain containing 11 [Source:HGNC Symbol;Acc:13607]
Mouse Orthologue:
Fbxw11
Mouse Description:
F-box and WD-40 domain protein 11 Gene [Source:MGI Symbol;Acc:MGI:2144023]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31968 Essential Splice Site Available for shipment Available now
sa12221 Essential Splice Site Available for shipment Available now
sa42328 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31968
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036901 Essential Splice Site 13 527 1 13
Genomic Location (Zv9):
Chromosome 14 (position 2127792)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150273.1 28829
GRCz11 14 2588049
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAACAATAATATGGATCCGGACAAGGAGGACAAAACCCTGGAGCTGATG[G/A]TACGTGCCGCCCGGTATCCACGACACCTCCTGCTCTGTATGTTTATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12221
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036901 Essential Splice Site 172 527 4 13
Genomic Location (Zv9):
Chromosome 14 (position 2149257)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150273.1 50294
GRCz11 14 2567435
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGGTGCGAACCGACCCACTGTGGAAAGGCCTGTCAGAGCGGCATCAATG[G/A]TAAAAGAACATNNNNACACTACATGTCACAGACGTAATGATGTTTCTACTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42328
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036901 Nonsense 512 527 12 13
Genomic Location (Zv9):
Chromosome 14 (position 2162985)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150273.1 64022
GRCz11 14 2553707
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGACGACACAATCCTTATATGGGACTTCCTGAATGTGTCCAGCAATGGG[C/T]AGTCGGACGGTCGGTCGCCCTCTCGGACATACACATACGTCTCCAGATAG
Associated Phenotype:
Not determined