Busch Lab

ZMP

itgb4

Ensembl ID:
ENSDARG00000028507
ZFIN ID:
ZDB-GENE-030131-7209
Description:
integrin, beta 4 [Source:RefSeq peptide;Acc:NP_001019557]
Human Orthologue:
ITGB4
Human Description:
integrin, beta 4 [Source:HGNC Symbol;Acc:6158]
Mouse Orthologue:
Itgb4
Mouse Description:
integrin beta 4 Gene [Source:MGI Symbol;Acc:MGI:96613]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa14803 Splice Site, Nonsense Available for shipment Available now
sa21220 Nonsense Available for shipment Available now
sa21221 Nonsense Available for shipment Available now
sa18596 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14803
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029308 Splice Site, Nonsense 188 1893 7 41

The following transcripts of ENSDARG00000028507 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 13633526)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13078870
GRCz11 8 13116575
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACNTTTTTTATCACACACTCATAATGTAGTWTGTTTTCTSTTTTACAGAT[T/G]AGCTGAGCCGTGGTCCAATAGCGACCCTCCATTTTCCTTCCGTAAMGTCA
Long Flanking Sequence:
AACAGGATGTGTTCTAGCTATTTTTACATTGGCTGTCATGTCACGTCTTGTTGTTCAATTTCATCTTGATTCATCAGTGTTGCTGTAGTTATATGGTCGTTCAAGAAATTCAGCTTTTAAATCCATATACTGAGTCCCTATTGGAGTCTGTTCCTTTCCAAATAATGTTGTCTTCTCATTTTTAAATCCAAAAACATTTTATAATTTGACGTACACTCATGAAGCATACTGTAAATTTGTGTGACCCACTTACAAAATACACAGGCCATGTGTCTATTTTAATATTCATTCATTGCCTGGTTTCACATCATTGCAGCACGGCTTGTTGGCGATCTCTCTGACGATTACACCATCGGATTTGGCAAGTTTGTGGACAAAGTCACCGAGCCTCAGACAGACATGAGGCCAGCCAAGTAAGAATCATGCAGTGTTACTGCAGCACACAGTTTGACTTTTTTTATCACACACTCATAATGTAGTATGTTTTCTGTTTTACAGAT[T/G]AGCTGAGCCGTGGTCCAATAGCGACCCTCCATTTTCCTTCCGTAACGTCATCAAGCTCACCAGCAACATCACCTCCTTCAGACAGAAGCTACAGAAAGAGCGTATATCTGGCAACCTTGATGCTCCAGAAGGTGGTTTTGATGCCATCTTACAGACTGCTGTCTGCCAGGTACTGACAGTTTTTCTTCAGGGGCAATTGAAAAATAAAACTGAATGGCTTGGCTGACATTTACAATGCTGTAAACAACAACTTACTTCTTAGCGGTGGAGTTAAGGCTTAAAACCAATATTTTGTTTGGTTATATTTTATTTTTTATAGTTATTATATTTTTTATATTATATTTTTTGTCATTTAATATTAATATTAATATTATATCCTTTATTTCGCCAGTAAAAAAGCACATTAAGATTAAACATCTCTTTTACAAGAACGTCCTGACCAAGATTAAGCAGTAGACAGTTCACATAGGTTTAACAAAAATAACAGATAACATTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21220
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029308 Nonsense 766 1893 20 41

The following transcripts of ENSDARG00000028507 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 13644119)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13089463
GRCz11 8 13127168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGGACAGGTCGTATGGTGGGCTTTAAAGAAAACCAGTACCTGCTACGT[C/T]AGTCTTTTCTGCAAAATGATTATTTGGACACCCCAATGGTGCGCAGCGGC
Long Flanking Sequence:
AAAATAAACAGCGGGGCTAATAATTCTGACTTCAACTGTATGTATATATATATATATATATATATATATAGAAGCTTGTCCGGGACACACAAAGCTCACAAGCATTGTTGCATGAAATGTTTTGCTAGACAATGCACTTTTTTTTTTTGGTGTATTGCAATACTGTAAAAATACAGTAAAGGCAAATGTTAGATAAGTAATTGCAAAGTTTCTTGAGGTCACATAACTTGTATGAGAAAACGCAAATATTTTGTTTTTGAGAAACTATTTTTGTCAGGAGAACACAATATTTCACCATAGATCTATTTATAATTGATGTCTGTCTCCAACAGTCCTGTCTTGCTCTTCTCCCGTGCTGTGCAAGAGGTAGTTATATGCTTTCATACGTACTTTAAGTTACGTTATCTATATTTTGGTGGAAACACACATAATTAATTGTCCTTAATATGTAATGGACAGGTCGTATGGTGGGCTTTAAAGAAAACCAGTACCTGCTACGT[C/T]AGTCTTTTCTGCAAAATGATTATTTGGACACCCCAATGGTGCGCAGCGGCCCGCTCAAGAGCACAGACGTTGTGCGCTGGAAAGTGGCAGACAATGTTCATCGAGGAACGAATCACCCCCAGAACCAAATCAGACCCAACCCCAAAGAGACCAGTGAGTCTAAACATTGTTTTTTATATTGTTTTTATTATTATTATTAATATTATTATTAAACAAATACTGGTAACACTTTACAGTGTTTTTGCTCCATGTAGTTAGTATAGAAATACCTTTAAAAAGTTTGTATATTTGCATGAAAGCAACCGTTAACCTAACATCATGCTAACAATTACCATATACTTTGTCGTTTCAAAGCCAGAGTCAAATAAAAGTTCATAAATGATATACATATCCATTAATCCCTCTGTATTTTTCCTCCTAGTCCAGTATCCTGTTTCTCTTCGTCTGAACCGCCAGTTTTCAGAAGTTCTTTCTAACCCTGACGCTCGGGACACAGACAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27146
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029308 Nonsense 1047 1893 27 41

The following transcripts of ENSDARG00000028507 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 13649314)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13094658
GRCz11 8 13132363
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTTTTGCATTCTCTCCTGTACAGGACTATATTTCGGTAGATGGAGACT[T/A]GAGCTATGGAGCAGGTGAAACAGAGAAGATTGTCCCAGTGAAACTTCTGG
Long Flanking Sequence:
TAATTACTTCATTATTCACAAATGTGCTGTAAATTTATGAAACATACCTGATTATTTATAACAAAACAAATATTACTCTTAAATATTATTTTAAATAGTTTGTCAATAAACGTGCATATACAGCATAAAAATTTTTCATACATATATTTTTAGATTTTAATTTTCCAAAAAAAATAAATAAATAAAATAAATAAATAAATAAATATATAAATTAAATAAATATATTTATTTAATATATATATATATATTATATATTCTAATATATTTTATAGAAGTTCACTGATGTTGATGTAACTTCATAGTTATGTGCTCCATACATATTGAAAATGCAATGTTGTACCATTGTTTATAAATAATTATGGCTCTTAAAATATGTTTTAATTATTTTATTAGTAATGGGTAATGGGAACATTCAGTTGTCATTGTTTGATTGCAGTATTTTTTTATACTACTTTTTGCATTCTCTCCTGTACAGGACTATATTTCGGTAGATGGAGACT[T/A]GAGCTATGGAGCAGGTGAAACAGAGAAGATTGTCCCAGTGAAACTTCTGGAACTTGGAGAGCAAGATGGCCTGCTGGAGGACAAGCAGGTCAAACAGTTTGTCATGGATTTGACCAACCCACGACAAAGTGCTAAACTAGGCCGTTACCCACGCACTGTTATCACCATCGCTGACAAACCAGGTACATATGAGCAATTCCATGCAAATGTCACCCTTGCCATGAAAAAATGAAGGTTTCACCAAAATAGCGAAATTCTTTCTACATTTTTTGTGTAAGCAAGTATTTTATAGTACTTCAAAAATACTGAAAAATGTCTGACAATGATTTCTAACAATTATATTTGATTTACCAAAGTCACACCAGTGGCAATTTCACATCTATCACATCCGTAACGGAGAGGTGTCACATCTATAAGGAAGCTTTTTCCTCATAAATGCAAAGATGTCACCTAAAATAAAATCAATCAATTTTGCTCTATAGAGAGCCGACTCTTACCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3685
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029308 Nonsense 1064 1893 27 41
ENSDART00000029308 Nonsense 1064 1893 27 41

The following transcripts of ENSDARG00000028507 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 13649364)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13094708
GRCz11 8 13132413
KASP Assay ID:
2260-0265.1 (used for ordering genotyping assays)
KASP Sequence:
TGAGCTATGGASMAGGTGAAACAGAGAAGATTGTCCCAGTGAAACTTCTG[G/T]AACTTGGAGAGCAAGATGGCCTGCTGGAGGACAARCAGGTCAAACAGTTT
Long Flanking Sequence:
ATTATTTATAACAAAACAAATATTACTCTTAAATATTATTTTAAATAGTTTGTCAATAAACGTGCATATACAGCATAAAAATTTTTCATACATATATTTTTAGATTTTAATTTTCCAAAAAAAATAAATAAATAAAATAAATAAATAAATAAATATATAAATTAAATAAATATATTTATTTAATATATATATATATATTATATATTCTAATATATTTTATAGAAGTTCACTGATGTTGATGTAACTTCATAGTTATGTGCTCCATACATATTGAAAATGCAATGTTGTACCATTGTTTATAAATAATTATGGCTCTTAAAATATGTTTTAATTATTTTATTAGTAATGGGTAATGGGAACATTCAGTTGTCATTGTTTGATTGCAGTATTTTTTTATACTACTTTTTGCATTCTCTCCTGTACAGGACTATATTTCGGTAGATGGAGACTTGAGCTATGGAGCAGGTGAAACAGAGAAGATTGTCCCAGTGAAACTTCTG[G/T]AACTTGGAGAGCAAGATGGCCTGCTGGAGGACAAGCAGGTCAAACAGTTTGTCATGGATTTGACCAACCCACGACAAAGTGCTAAACTAGGCCGTTACCCACGCACTGTTATCACCATCGCTGACAAACCAGGTACATATGAGCAATTCCATGCAAATGTCACCCTTGCCATGAAAAAATGAAGGTTTCACCAAAATAGCGAAATTCTTTCTACATTTTTTGTGTAAGCAAGTATTTTATAGTACTTCAAAAATACTGAAAAATGTCTGACAATGATTTCTAACAATTATATTTGATTTACCAAAGTCACACCAGTGGCAATTTCACATCTATCACATCCGTAACGGAGAGGTGTCACATCTATAAGGAAGCTTTTTCCTCATAAATGCAAAGATGTCACCTAAAATAAAATCAATCAATTTTGCTCTATAGAGAGCCGACTCTTACCCTTTTAAATAGCATTATTTCTTTTGGGTTGTGCGATTTAACTCACAGAATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18911
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029308 Nonsense 1064 1893 27 41
ENSDART00000029308 Nonsense 1064 1893 27 41

The following transcripts of ENSDARG00000028507 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 13649364)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13094708
GRCz11 8 13132413
KASP Assay ID:
2260-0265.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGCTATGGAGCAGGTGAAACAGAGAAGATTGTCCCAGTGAAACTTCTG[G/T]AACTTGGAGAGCAAGATGGCCTGCTGGAGGACAAGCAGGTCAAACAGTTT
Long Flanking Sequence:
ATTATTTATAACAAAACAAATATTACTCTTAAATATTATTTTAAATAGTTTGTCAATAAACGTGCATATACAGCATAAAAATTTTTCATACATATATTTTTAGATTTTAATTTTCCAAAAAAAATAAATAAATAAAATAAATAAATAAATAAATATATAAATTAAATAAATATATTTATTTAATATATATATATATATTATATATTCTAATATATTTTATAGAAGTTCACTGATGTTGATGTAACTTCATAGTTATGTGCTCCATACATATTGAAAATGCAATGTTGTACCATTGTTTATAAATAATTATGGCTCTTAAAATATGTTTTAATTATTTTATTAGTAATGGGTAATGGGAACATTCAGTTGTCATTGTTTGATTGCAGTATTTTTTTATACTACTTTTTGCATTCTCTCCTGTACAGGACTATATTTCGGTAGATGGAGACTTGAGCTATGGAGCAGGTGAAACAGAGAAGATTGTCCCAGTGAAACTTCTG[G/T]AACTTGGAGAGCAAGATGGCCTGCTGGAGGACAAGCAGGTCAAACAGTTTGTCATGGATTTGACCAACCCACGACAAAGTGCTAAACTAGGCCGTTACCCACGCACTGTTATCACCATCGCTGACAAACCAGGTACATATGAGCAATTCCATGCAAATGTCACCCTTGCCATGAAAAAATGAAGGTTTCACCAAAATAGCGAAATTCTTTCTACATTTTTTGTGTAAGCAAGTATTTTATAGTACTTCAAAAATACTGAAAAATGTCTGACAATGATTTCTAACAATTATATTTGATTTACCAAAGTCACACCAGTGGCAATTTCACATCTATCACATCCGTAACGGAGAGGTGTCACATCTATAAGGAAGCTTTTTCCTCATAAATGCAAAGATGTCACCTAAAATAAAATCAATCAATTTTGCTCTATAGAGAGCCGACTCTTACCCTTTTAAATAGCATTATTTCTTTTGGGTTGTGCGATTTAACTCACAGAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21221
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029308 Nonsense 1088 1893 27 41

The following transcripts of ENSDARG00000028507 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 13649436)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13094780
GRCz11 8 13132485
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGGAGGACAAGCAGGTCAAACAGTTTGTCATGGATTTGACCAACCCA[C/T]GACAAAGTGCTAAACTAGGCCGTTACCCACGCACTGTTATCACCATCGCT
Long Flanking Sequence:
GCATAAAAATTTTTCATACATATATTTTTAGATTTTAATTTTCCAAAAAAAATAAATAAATAAAATAAATAAATAAATAAATATATAAATTAAATAAATATATTTATTTAATATATATATATATATTATATATTCTAATATATTTTATAGAAGTTCACTGATGTTGATGTAACTTCATAGTTATGTGCTCCATACATATTGAAAATGCAATGTTGTACCATTGTTTATAAATAATTATGGCTCTTAAAATATGTTTTAATTATTTTATTAGTAATGGGTAATGGGAACATTCAGTTGTCATTGTTTGATTGCAGTATTTTTTTATACTACTTTTTGCATTCTCTCCTGTACAGGACTATATTTCGGTAGATGGAGACTTGAGCTATGGAGCAGGTGAAACAGAGAAGATTGTCCCAGTGAAACTTCTGGAACTTGGAGAGCAAGATGGCCTGCTGGAGGACAAGCAGGTCAAACAGTTTGTCATGGATTTGACCAACCCA[C/T]GACAAAGTGCTAAACTAGGCCGTTACCCACGCACTGTTATCACCATCGCTGACAAACCAGGTACATATGAGCAATTCCATGCAAATGTCACCCTTGCCATGAAAAAATGAAGGTTTCACCAAAATAGCGAAATTCTTTCTACATTTTTTGTGTAAGCAAGTATTTTATAGTACTTCAAAAATACTGAAAAATGTCTGACAATGATTTCTAACAATTATATTTGATTTACCAAAGTCACACCAGTGGCAATTTCACATCTATCACATCCGTAACGGAGAGGTGTCACATCTATAAGGAAGCTTTTTCCTCATAAATGCAAAGATGTCACCTAAAATAAAATCAATCAATTTTGCTCTATAGAGAGCCGACTCTTACCCTTTTAAATAGCATTATTTCTTTTGGGTTGTGCGATTTAACTCACAGAATTTCTACAAAGTATGTTGTATACTTTAAACTCGCTAACTTTTTTGCTCACATCAATAAAGCATGACTATTTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18596
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029308 Nonsense 1227 1893 29 41

The following transcripts of ENSDARG00000028507 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 13652322)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13097666
GRCz11 8 13135371
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGAACATTTCAGGGGATGGTAAAAATCAGGATTTCCAGAAGATGGAMTA[T/G]GTTACTCAAACAGCCACATCCYCCGGAGGACGCCTCTATTCTCCAGCCAA
Long Flanking Sequence:
ATATTGAAAAATGAGAACGAGCAATGCATCTGGCTTTATGCTTCATTTTTATCCATCTTAAAATTATTTATGCTTGGTTATTTTATCAAGACATTAGCATTACATGCATATCTAAGGCCGAAACTCTTTTGAGTTCACTGTTTTATTCCTACAAATTGTCCTCTTTATATTCCATACAGTAAAGTAATAGTCCAAATTGCCATGCGAAGATTCGTGAGTTTTTTGGGGTTGTGTGTGGTCTGCTAAAAGTCATTTTGTTTATTCTAATAAATTATTTTTTAAAATTTTCAAATTGATAAACTTTGAGGAAAGTTATAACAAACTTGTCGTCACCCTTTTTTTAAAACATTGCAGATTGTTTACAGTTTAATATAAGTTACTTAAACATTTTGGCAGTAGGAAAAAGGTAGATAATCAGCAGATACTAGAAATGATAATTATTATTTGCATTTGAACATTTCAGGGGATGGTAAAAATCAGGATTTCCAGAAGATGGAATA[T/G]GTTACTCAAACAGCCACATCCCCCGGAGGACGCCTCTATTCTCCAGCCAACATTAAAGCCGTTGCTACCGGCCCTAAAAACATCCGCCTGAACTGGAAACCCAGCCAAAATGCCAATGGTTACAAGGTAGATCTTGTCAAATAATATCTACTGCATATATAGATCCTTTTTTGACTTATTTATTTATTTATTTATTTATTGTGTACATCTGTAGAATTTATTTATCAAAAAATAAACAACGGTATCCGTAAATGAACAAACTGTAAATGAAGAGTGTGAAATGTGTGAAGCCTTTAAGCAGTTCCTAAGTGTTTACTTTATGACCAATATAACCAGTATCATTACTGTGTCTTTTCTAAATAATAGGACATTTTTTGTTCTGTATAACATCACTGACCACAAACTTTTGAATAACAGTGTATGTGACATGAAATGACAGGTTAGCTTGATATTGGGCTGTTTTTTTTAGCCATTTTTCTTTTTAGAAACACCACAGGAGC
Associated Phenotype:
Not determined