Busch Lab

ZMP

stxbp6l

Ensembl ID:
ENSDARG00000028354
ZFIN ID:
ZDB-GENE-040724-16
Description:
syntaxin-binding protein 6 [Source:RefSeq peptide;Acc:NP_001018574]
Human Orthologue:
STXBP6
Human Description:
syntaxin binding protein 6 (amisyn) [Source:HGNC Symbol;Acc:19666]
Mouse Orthologue:
Stxbp6
Mouse Description:
syntaxin binding protein 6 (amisyn) Gene [Source:MGI Symbol;Acc:MGI:2384963]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4135
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053844 None None 144 None 5
ENSDART00000064165 Nonsense 149 278 4 7
ENSDART00000080691 Nonsense 149 278 4 7
Genomic Location (Zv9):
Chromosome 20 (position 10012584)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9844513
GRCz11 20 9831753
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
WCTGGGAGGCGAAGCTCAGCCAGGAAAAACCAACATCCCCTGKAGGCCAG[A/T]AGACACCAGGAGCTGTGGAGAGCAAGAAGAGCYCTGCTGCAACAAACCAA
Associated Phenotype:
Not determined