Busch Lab

ZMP

hmga1

Ensembl ID:
ENSDARG00000028335
ZFIN ID:
ZDB-GENE-010502-1
Description:
high mobility group AT-hook 1 [Source:RefSeq peptide;Acc:NP_998333]
Human Orthologue:
HMGA1
Human Description:
high mobility group AT-hook 1 [Source:HGNC Symbol;Acc:5010]
Mouse Orthologues:
Hmga1, Hmga1-rs1
Mouse Descriptions:
high mobility group AT-hook 1 Gene [Source:MGI Symbol;Acc:MGI:96160]
high mobility group AT-hook I, related sequence 1 Pseudogene [Source:MGI Symbol;Acc:MGI:96161]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa16984 Essential Splice Site Available for shipment Available now
sa37600 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16984
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028885 Essential Splice Site 61 101 None 5
ENSDART00000131536 Essential Splice Site 60 100 None 5
ENSDART00000132205 Essential Splice Site 61 101 None 5
ENSDART00000137826 Essential Splice Site 61 101 None 5
ENSDART00000139408 None None 45 None 2

The following transcripts of ENSDARG00000028335 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 3770910)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 3814265
GRCz11 23 3757168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCAAAGGGCAGCAAAAACAAGCCGAGCTCTACTGTGTCTCGGGGCAAAG[T/C]GAGTAGAAGTGTAATWTTGTCGAGGTGCACAAAACCACAGAGACTATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37600
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028885 Nonsense 77 101 4 5
ENSDART00000131536 Nonsense 76 100 4 5
ENSDART00000132205 Nonsense 77 101 4 5
ENSDART00000137826 Nonsense 77 101 4 5
ENSDART00000139408 None None 45 None 2

The following transcripts of ENSDARG00000028335 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 3770078)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 3813433
GRCz11 23 3756336
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGAAAGCAGCAGCGGCTTCGGCACCTGCAGGGACTAAACGCCGAGGA[C/T]GACCCAAGAAAGCAGTGAGTATTTGTGTGTTGTGCTTTTAAAGGGGCAGT
Associated Phenotype:
Not determined