Busch Lab

ZMP

si:ch73-237c6.4

Ensembl ID:
ENSDARG00000028295
ZFIN ID:
ZDB-GENE-030131-5954
Description:
hypothetical protein LOC559882 [Source:RefSeq peptide;Acc:NP_001121808]
Human Orthologues:
MKRN1, MKRN3
Human Descriptions:
makorin ring finger protein 1 [Source:HGNC Symbol;Acc:7112]
makorin ring finger protein 3 [Source:HGNC Symbol;Acc:7114]
Mouse Orthologues:
Mkrn1, Mkrn3
Mouse Descriptions:
makorin, ring finger protein, 1 Gene [Source:MGI Symbol;Acc:MGI:1859353]
makorin, ring finger protein, 3 Gene [Source:MGI Symbol;Acc:MGI:2181178]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa27197 Nonsense Mutation detected in F1 DNA Not yet available
sa16544 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27197
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104346 Nonsense 27 397 2 8
ENSDART00000132734 Nonsense 32 161 2 3
ENSDART00000142395 Nonsense 17 161 1 3
Genomic Location (Zv9):
Chromosome 8 (position 24579751)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23705569
GRCz11 8 23726808
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGGATTTGTTGTTGCTCTTTTGCAGGCAGTTCATCAATGGATCGTGT[C/T]GATATGGTCAAAGTTGTTACTACCTACACGAGTTTCCTTCAGTTCCGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16544
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104346 Nonsense 250 397 5 8
ENSDART00000132734 None None 161 None 3
ENSDART00000142395 None None 161 None 3
Genomic Location (Zv9):
Chromosome 8 (position 24581197)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23707015
GRCz11 8 23728254
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGTGGCATCTGCATGGACAAGATTTCTGAGAAATCCACCGCTCAGGAA[C/T]GACGTTRCGGCATCCTACCCAACTGCAATCATGCTTTCTGCATTGGCTGC
Associated Phenotype:
Not determined