Busch Lab

ZMP

si:ch211-233f10.5

Ensembl ID:
ENSDARG00000028236
ZFIN IDs:
ZDB-GENE-060526-119, ZDB-GENE-100119-2
Description:
Collagen alpha-1(XXVII) chain B [Source:UniProtKB/Swiss-Prot;Acc:A0MSJ1]
Human Orthologue:
COL27A1
Human Description:
collagen, type XXVII, alpha 1 [Source:HGNC Symbol;Acc:22986]
Mouse Orthologue:
Col27a1
Mouse Description:
collagen, type XXVII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2672118]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa14233 Essential Splice Site Available for shipment Available now
sa31484 Essential Splice Site Available for shipment Available now
sa9794 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26611
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097297 Nonsense 162 1619 1 59
ENSDART00000137363 None None 1083 None 51
Genomic Location (Zv9):
Chromosome 5 (position 67819358)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64620031
GRCz11 5 65309028
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGATCCAGAGGGCTCCTTTCGCTTGGGAAAAATGAGCCAGAACTCAGTG[C/T]AGTTCGAAGGAGCCATCTGCCAGTTTGACATTCATCCCTCTGCTCAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14233
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097297 Essential Splice Site 753 1619 22 59
ENSDART00000137363 Essential Splice Site 281 1083 17 51
Genomic Location (Zv9):
Chromosome 5 (position 67734406)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64536047
GRCz11 5 65225044
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAGGGAGAGCCTGGAATGAYTGGAAATCCTGGGATGCTTGGTGAGAGGG[T/C]AAAGGATTTGATGGATTTTTGGTATAKTAGTTAACACTTTTAATCTATAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1908
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097297 Nonsense 1012 1619 36 59
ENSDART00000137363 Nonsense 514 1083 31 51
Genomic Location (Zv9):
Chromosome 5 (position 67705437)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64507078
GRCz11 5 65196075
KASP Assay ID:
554-1898.1 (used for ordering genotyping assays)
KASP Sequence:
TAMTGTCATTTCAGGGCCCTGAAGGCAAAATAGGGAAAACTGGTGAGAGG[G/T]GAAAACCTGGAGAGAAGGTATTTTATGTTTGYTTGACATTTTAATTTAYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31484
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097297 Essential Splice Site 1017 1619 36 59
ENSDART00000137363 Essential Splice Site 519 1083 31 51
Genomic Location (Zv9):
Chromosome 5 (position 67705418)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64507059
GRCz11 5 65196056
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGGCAAAATAGGGAAAACTGGTGAGAGGGGAAAACCTGGAGAGAAGG[T/C]ATTTTATGTTTGCTTGACATTTTAATTTACAAGCTTTACCAGTTTTCAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26610
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097297 Nonsense 1064 1619 38 59
ENSDART00000137363 Nonsense 566 1083 33 51
Genomic Location (Zv9):
Chromosome 5 (position 67703721)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64505362
GRCz11 5 65194359
KASP Assay ID:
2259-6777.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTGGTTATCATATTCAGGGTGCGACGGGAAAAATGGGTCAGCACGGA[G/T]AGCCAGGTTTGGTGGGATATGAAGTAAGTGTTTTTTAAACATGGCTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9794
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097297 Essential Splice Site 1108 1619 40 59
ENSDART00000137363 Essential Splice Site 610 1083 35 51
Genomic Location (Zv9):
Chromosome 5 (position 67703300)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64504941
GRCz11 5 65193938
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGGCRATGACGGGAAGGTTGAAGGTCYACCTGGTCCTTCTRGTGACATC[G/A]TGAGTCAGTCCATTAAATATATTTTAACTTAGTTTTGGAGAATATYGGGT
Associated Phenotype:
Not determined