Busch Lab

ZMP

cradd

Ensembl ID:
ENSDARG00000028192
ZFIN ID:
ZDB-GENE-041010-168
Description:
death domain-containing protein CRADD [Source:RefSeq peptide;Acc:NP_001006066]
Human Orthologue:
CRADD
Human Description:
CASP2 and RIPK1 domain containing adaptor with death domain [Source:HGNC Symbol;Acc:2340]
Mouse Orthologue:
Cradd
Mouse Description:
CASP2 and RIPK1 domain containing adaptor with death domain Gene [Source:MGI Symbol;Acc:MGI:1336168]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26278
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033717 Essential Splice Site 102 200 1 2
Genomic Location (Zv9):
Chromosome 4 (position 17484443)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18427283
GRCz11 4 18416259
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGCTGCAACTAAACGAGGAAGAAGAGTCTCCTCCTCCGCCCTTCACAG[G/A]TGAGTCCTAAGAGCTGAAACTGACTGAACATCCAGAGGACAGAAATATGT
Associated Phenotype:
Not determined