Busch Lab

ZMP

slc4a2a

Ensembl ID:
ENSDARG00000028173
ZFIN ID:
ZDB-GENE-051101-2
Description:
solute carrier family 4, anion exchanger, member 2a [Source:RefSeq peptide;Acc:NP_001032314]
Human Orthologue:
SLC4A2
Human Description:
solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1) [Sou
Mouse Orthologue:
Slc4a2
Mouse Description:
solute carrier family 4 (anion exchanger), member 2 Gene [Source:MGI Symbol;Acc:MGI:109351]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa19799 Nonsense Available for shipment Available now
sa8405 Nonsense Mutation detected in F1 DNA Not yet available
sa32951 Nonsense Available for shipment Available now
sa14280 Essential Splice Site Available for shipment Available now
sa6851 Nonsense Mutation detected in F1 DNA Not yet available
sa39861 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30823 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19799
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041319 Nonsense 388 1228 9 23
ENSDART00000129758 Nonsense 388 1228 10 24
ENSDART00000132792 None None 42 None 4
Genomic Location (Zv9):
Chromosome 2 (position 32134008)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32432915
GRCz11 2 32416133
KASP Assay ID:
2259-2219.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAGAAAATCTATTGATATACTGATAATGTGATTTTACAGGTGCGGTGT[T/A]GCTAGATCTGGACCAGAAGACCCTGCCTGGCATTGCTCATCAGGTTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8405
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041319 Nonsense 537 1228 12 23
ENSDART00000129758 Nonsense 537 1228 13 24
ENSDART00000132792 None None 42 None 4
Genomic Location (Zv9):
Chromosome 2 (position 32132138)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32431045
GRCz11 2 32414263
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCTGATGCAGATGACTNNGRTTTTCGCAGGCTGTGTGGATTTCCTGGAT[C/T]AGCCCACCATGGCTTTTGTGAGACTAAAGGAAGCGGTTCTGTTGGAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32951
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041319 Nonsense 577 1228 12 23
ENSDART00000129758 Nonsense 577 1228 13 24
ENSDART00000132792 None None 42 None 4
Genomic Location (Zv9):
Chromosome 2 (position 32132016)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32430923
GRCz11 2 32414141
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCGGTTTCTGTTTGTGCTACTTGGCCCACCGAGTGCCAACATTGACTA[C/A]CACCAAATCGGCCGCTCCATATCGACACTTATGTCTGATAAAGTAAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14280
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041319 Essential Splice Site 591 1228 12 23
ENSDART00000129758 Essential Splice Site 591 1228 13 24
ENSDART00000132792 None None 42 None 4
Genomic Location (Zv9):
Chromosome 2 (position 32131972)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32430879
GRCz11 2 32414097
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGACTACCACCAAATYGGCCGCTCCATATCGACACTTATGWCTGATAAAG[T/G]AAGCACAAAGTTAACCAAGATCATTTTCCACCCAAATTTTATTTCGTCTK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6851
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041319 Nonsense 656 1228 13 23
ENSDART00000129758 Nonsense 656 1228 14 24
ENSDART00000132792 None None 42 None 4
Genomic Location (Zv9):
Chromosome 2 (position 32130635)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32429542
GRCz11 2 32412760
KASP Assay ID:
554-5256.1 (used for ordering genotyping assays)
KASP Sequence:
AAGAGATGCTGCACAAGAGACACGAGCAGGAGGTTAAACTACAGGCCAAA[G/T]AGCCCAAGAGCCCAGATGACATCGGTACAAGGCTCTATTTGAGAAAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39861
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041319 Essential Splice Site 1087 1228 20 23
ENSDART00000129758 Essential Splice Site 1087 1228 21 24
ENSDART00000132792 None None 42 None 4
ENSDART00000041319 Essential Splice Site 1087 1228 20 23
ENSDART00000129758 Essential Splice Site 1087 1228 21 24
ENSDART00000132792 None None 42 None 4
Genomic Location (Zv9):
Chromosome 2 (position 32119966)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32418873
GRCz11 2 32402091
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAAGTAAAAGAGCAGAGAGTCACTGGGTTTCTGGTGGCTCTTCTAGTAG[G/A]TGAGCGGATGATTCATTGCATGGATGATCAGTTTAGGCATGCATAATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30823
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041319 Essential Splice Site 1087 1228 20 23
ENSDART00000129758 Essential Splice Site 1087 1228 21 24
ENSDART00000132792 None None 42 None 4
ENSDART00000041319 Essential Splice Site 1087 1228 20 23
ENSDART00000129758 Essential Splice Site 1087 1228 21 24
ENSDART00000132792 None None 42 None 4
Genomic Location (Zv9):
Chromosome 2 (position 32119966)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32418873
GRCz11 2 32402091
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAAGTAAAAGAGCAGAGAGTCACTGGGTTTCTGGTGGCTCTTCTAGTAG[G/A]TGAGCGGATGATTCATTGCATGGATGATCAGTTTAGGCATGCATAATAGT
Associated Phenotype:
Not determined