Busch Lab

ZMP

si:ch211-95j8.2

Ensembl ID:
ENSDARG00000028096
ZFIN ID:
ZDB-GENE-091204-28
Description:
LOC553515 protein [Source:UniProtKB/TrEMBL;Acc:Q4V9J3]
Human Orthologue:
CLDN23
Human Description:
claudin 23 [Source:HGNC Symbol;Acc:17591]
Mouse Orthologues:
Cldn13, Cldn23
Mouse Descriptions:
claudin 13 Gene [Source:MGI Symbol;Acc:MGI:1913102]
claudin 23 Gene [Source:MGI Symbol;Acc:MGI:1919158]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2577
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038401 Nonsense 219 280 1 1
Genomic Location (Zv9):
Chromosome 10 (position 15076671)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15089978
GRCz11 10 15048097
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAACAASAGAAAGGCCTGTGCCCAGACCAACGGCTCAAACGAGGAGCTAC[A/T]GACCAAGAAATGAGAGTCCAAGCAATTCCAGCAGCGTACCRTACTCGCAG
Long Flanking Sequence:
GCTGCTTGACCTACTCATCAACTAGAACCCAAACATGCAACCAACAAGGCAACGACCAAATCTACTTCAAAAACCAAATCATTCCGATTGCTCAAGGAATGATGGTCGCATCCTTGATCGTAACTGCTCTCGGCTTGGTGGTGGCAACTCCTGGGGTTCGATGCTGGAGGGAAAAACCCAGATGGATACTGGCTGCGCTGGGTGGCCTACTTATTTTCTGTTCCGGTGTCCTGACCATCATTCCAATTGCGTGGTACACTCACATATTGACAAGCATCAATTCCACAATGGTCATAAGAAGCTCAACGACGACCCCTGACATCCGTGTAGGATACTGCATAATTTTGGGCTACATCGGAGGCATCATGGAGGTTCTCGGTGGTTTTGTGATGTTCATCGGGATTTGCTCCTGCTGCGGGGGACGGAATCGTGGAGAAAAGCCTCAACCCAAAACAACAGAAAGGCCTGTGCCCAGACCAACGGCTCAAACGAGGAGCTAC[A/T]GACCAAGAAATGAGAGTCCAAGCAATTCCAGCAGCGTACCGTACTCGCAGAAGTCTCTGGACGATGACCTGGACTTCCCAAGAGCCAAAACCAGAGAGAGAGACAGAGGTAGAGGAACAGACAGAGGGAGAGATTTGGCATCAGTCAACGCATCCTACACTGGAAGGCCGTATGATGCTGATCTCTAGAGGTATTAACTTGGTTAAGACATACTGTGAATATTCCTTTACAATTTTGTGAGTGTTGATGACGAAGCTGTTTGAACAACTGGAGTGTAAATTCCTGGAATTGTTGTTACACCAGTTTTTTTTTTTTTACAATGTATAAGTACACATATTTTTGGAAGTATGTTTCATGAGAATACTAGCCTTTCTGCTTCTGTGTTTAACTGCAATTCAATGTCTTGTTTGATGTATATTTGTATGTATGAATTGTGAATTTTCTACAGCATTTTTTTACAAGTATACAAGTGTACTTTAAATGTTTACAGCAGTTACTGT
Associated Phenotype:
Not determined