Busch Lab

ZMP

traf6

Ensembl ID:
ENSDARG00000028058
ZFIN ID:
ZDB-GENE-030131-5735
Description:
TNF receptor-associated factor 6 [Source:UniProtKB/Swiss-Prot;Acc:Q6IWL4]
Human Orthologue:
TRAF6
Human Description:
TNF receptor-associated factor 6 [Source:HGNC Symbol;Acc:12036]
Mouse Orthologue:
Traf6
Mouse Description:
TNF receptor-associated factor 6 Gene [Source:MGI Symbol;Acc:MGI:108072]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa244 Nonsense F2 line generated Not yet available
sa151 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa244
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038273 Nonsense 19 542 2 7
Genomic Location (Zv9):
Chromosome 7 (position 50190596)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48460832
GRCz11 7 48733608
KASP Assay ID:
554-2571.1 (used for ordering genotyping assays)
KASP Sequence:
CTTGCAAYGACGTGGACAAGTCCAGCTTCGAYGATGTCTGCTGTGACAGC[G/T]GACACTCGAGTTGTGCTGCAGCTATGGAGAAGGAGAGGGAGTCGTTTCTG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa151
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038273 Nonsense 166 542 4 7
Genomic Location (Zv9):
Chromosome 7 (position 50185417)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48455653
GRCz11 7 48728429
KASP Assay ID:
554-0746.1 (used for ordering genotyping assays)
KASP Sequence:
CAGAAACACTTGTCTCAGTGCAGGTTTGCCACTGCGCCGTGCCCTCAATG[T/A]CAGGAGTCTGTTCCCATAAGCCACCTGGATGAACATAAGAGCCAGCATTG
Associated Phenotype:
Not determined