Busch Lab

ZMP

im:7138629

Ensembl ID:
ENSDARG00000028056
ZFIN IDs:
ZDB-GENE-050208-92, ZDB-GENE-050208-92
Description:
Im:7138629 protein [Source:UniProtKB/TrEMBL;Acc:Q5CZP7]
Human Orthologue:
KNTC1
Human Description:
kinetochore associated 1 [Source:HGNC Symbol;Acc:17255]
Mouse Orthologue:
Kntc1
Mouse Description:
kinetochore associated 1 Gene [Source:MGI Symbol;Acc:MGI:2673709]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa30622 Nonsense Mutation detected in F1 DNA Not yet available
sa13054 Essential Splice Site Available for shipment Available now
sa33760 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33761 Nonsense Mutation detected in F1 DNA Not yet available
sa31487 Nonsense Available for shipment Available now
sa26620 Nonsense Mutation detected in F1 DNA Not yet available
sa33762 Nonsense Mutation detected in F1 DNA Not yet available
sa45236 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa2200 Nonsense F2 line generated Not yet available
sa9431 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30622
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 None None 522 None 16
ENSDART00000097285 Nonsense 493 859 22 32
ENSDART00000124886 None None 1025 None 27
Genomic Location (Zv9):
Chromosome 5 (position 69452104)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65778943
GRCz11 5 66458048
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGCCCCAGAACTGATTCCTGCAGTAGTCGAGAGCAGCGTTGAACCATA[C/A]GCTCTAGAGAATGGATTGGACCTGGACCAGACTCTACTAGATTATATCAA
Long Flanking Sequence:
TAATTTGTTTTTCAGGCTGAAATCTGTGGAGCAGAGGAAGTGGAAAGTCTGAGATCACTTGTGGCAAACCTTCGGCAGCTTTGTGACCTCTACATCAAATATAATTGCCACCTTTCACTGTCTGACTATGAACGAGTGAGTAGGAAAGTTTATATTGTTCTATAAAGTTTATATAGAGTGAAAGATATTATAGTGACCTTGCAAGTATTAAATATTTAAGCAAGGGTTTGAAGTTATTGTCACTCGTGTTTTAAGTACAGTAGTACATATAACTCGTGTTCTTCTTGTTTTTAGCATCGAAACAAAATGTCATAACAATGTCATAACTGAAAATGTTGCCATTAAGACAGTTTGAACTAGGGCTGTATGATACTGGGAGAATATGAGCTATTGTGTGTTTTGTGGCAGGGAAGCACACGTAGCATGGCCTTTCTGATGCTGGATAAGGTGCAAGCCCCAGAACTGATTCCTGCAGTAGTCGAGAGCAGCGTTGAACCATA[C/A]GCTCTAGAGAATGGATTGGACCTGGACCAGACTCTACTAGATTATATCAAGGTCACCTTTTCTTTTGTTTTTACTGTGGTGTTAACTACAGTAAATGCAATAGGGGTTAGGGCTACCCAATTAATCTGAAAAACAGTTTTGAGGATGATAGTTTTCGCAATTTAGTTTAGGAAAATTGATGTTTACCACTTTATTTTTAGATGTACTATATATTCTGTTTAACAAAGAGATTTTTTTCATCACATTTCTAAACAATAAATTTAATAACTCATTTCTAATAACTGATTTCTTTTATCTTTGCCGTGATAACTGCACATAAAATTTGACTAGATATTTTTCAAGGCACTAGTATTCAGCTTAAAGTGACATTTAAAAGACTTAAATAGGTTAACTAGGCAAGTTAGGGTAATAGGCAAGTCATTTTATAACAGTGATAATATAGACCTTAAATAATATTGTAATAATATTGACTTTAAAATGGTTGTAAAAAATTAAAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13054
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 None None 522 None 16
ENSDART00000097285 Essential Splice Site 612 859 26 32
ENSDART00000124886 None None 1025 None 27
Genomic Location (Zv9):
Chromosome 5 (position 69457535)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65784366
GRCz11 5 66463471
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCTCTTTGGTCTTTCAAGTACCTGATATTACATGTTGTTTRCTTTGCTT[A/T]GATGCTTGTGAGGTACATCCTGAAGCAAGACCTGCCCACTTCTCTRGAGG
Long Flanking Sequence:
TATGAGTCGACTTTTATAGATGATTCAATAGTTTTAAACACTGTACACTTACAGATTTAAGCCTTAGCTGGATATTTCACTTCACTTAGAGCTGTGTTACACACCACATGAAAGGGCATTTTCAAAAACCCATAATATGGGCTCTTTAAATGGTATTGAAATTCACTTTCTGATTTCTGCATTTACTCGGTCAAATGCAGTTCAAATACCATCTGTGGCTGTTTTGTTTCTGCTCAATGTTCAACACAACAATTGTCTGTTTTTTTGTTCATTATAGATCAAGGAAAATTCTGGAAAAGTCAGGGAATTTGACATTTTAGATTTTAGAATGAGAACCCTGTATACAGTATATCAAAAGACAAATAACAAATATCAGATAATACAGACCAGACAGCCAATGTATTTTGTATTCTCATAATTGATTATTCTATACTGGATTAAAAATGCAAAGGCTCTTTGGTCTTTCAAGTACCTGATATTACATGTTGTTTGCTTTGCTT[A/T]GATGCTTGTGAGGTACATCCTGAAGCAAGACCTGCCCACTTCTCTGGAGGACTCGCTAAAGCTAATCGAGGCCTACAAACTAAACCCAGCAGAGTTCCACCATCTTCACTGCATCCAGCTTATACAGCGCAACAAGGTATTACTCTTACAGAATTGACTATTCTTCTTAAGATTATGAAGGGCACATGGTATAGAAATTCTATTGCTTGTGTTCAGTGTTTACTGGATGTTGTATGTTTTGCACACTGTAAAAAAAGTACATTTAGATTTCTAGAATCTTCCTTCTGGGATTTTTCTTCATTTAGGACAGCTGAGAAATATTTTAGATTTTTTTCACATTGTCTTTGCAGAGGGAGAAGTGCACCACACTGCTGAAGAGTCTGCCACATTCTGAAGCCATATTTGTAATTGAGCGAATGGCATGCTGGGCAAGACTCGAACTCCAAGACAAGCAACACATTTCTGAAGAGGTCAGAAGTTACATGAGAGAAATAGTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33760
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 None None 522 None 16
ENSDART00000097285 Essential Splice Site 656 859 26 32
ENSDART00000124886 None None 1025 None 27
Genomic Location (Zv9):
Chromosome 5 (position 69457673)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65784504
GRCz11 5 66463609
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGAGTTCCACCATCTTCACTGCATCCAGCTTATACAGCGCAACAAGG[T/C]ATTACTCTTACAGAATTGACTATTCTTCTTAAGATTATGAAGGGCACATG
Long Flanking Sequence:
GGGCTCTTTAAATGGTATTGAAATTCACTTTCTGATTTCTGCATTTACTCGGTCAAATGCAGTTCAAATACCATCTGTGGCTGTTTTGTTTCTGCTCAATGTTCAACACAACAATTGTCTGTTTTTTTGTTCATTATAGATCAAGGAAAATTCTGGAAAAGTCAGGGAATTTGACATTTTAGATTTTAGAATGAGAACCCTGTATACAGTATATCAAAAGACAAATAACAAATATCAGATAATACAGACCAGACAGCCAATGTATTTTGTATTCTCATAATTGATTATTCTATACTGGATTAAAAATGCAAAGGCTCTTTGGTCTTTCAAGTACCTGATATTACATGTTGTTTGCTTTGCTTAGATGCTTGTGAGGTACATCCTGAAGCAAGACCTGCCCACTTCTCTGGAGGACTCGCTAAAGCTAATCGAGGCCTACAAACTAAACCCAGCAGAGTTCCACCATCTTCACTGCATCCAGCTTATACAGCGCAACAAGG[T/C]ATTACTCTTACAGAATTGACTATTCTTCTTAAGATTATGAAGGGCACATGGTATAGAAATTCTATTGCTTGTGTTCAGTGTTTACTGGATGTTGTATGTTTTGCACACTGTAAAAAAAGTACATTTAGATTTCTAGAATCTTCCTTCTGGGATTTTTCTTCATTTAGGACAGCTGAGAAATATTTTAGATTTTTTTCACATTGTCTTTGCAGAGGGAGAAGTGCACCACACTGCTGAAGAGTCTGCCACATTCTGAAGCCATATTTGTAATTGAGCGAATGGCATGCTGGGCAAGACTCGAACTCCAAGACAAGCAACACATTTCTGAAGAGGTCAGAAGTTACATGAGAGAAATAGTCTGTGGTTCTCAACAGTTCTGTGGATCCACCCCATATACACTAACCAGCCACTTTATTAGGTACACCTTACTAGTAACAGCTTGAACCCCCTTTTGCCTTGAGAACTGCCTTAATCATTCATGGCATAGATTCAACAAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33761
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 None None 522 None 16
ENSDART00000097285 Nonsense 777 859 31 32
ENSDART00000124886 None None 1025 None 27
Genomic Location (Zv9):
Chromosome 5 (position 69467299)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65794075
GRCz11 5 66473180
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAATACATGTTTCTGTTTACCTCATGAAGCGAGTTATATCAGCACCACT[C/A]GAACTGCAGCACAGGACGTGTTTTGTTCAGCACCGCCCAGCGCCTCTGCC
Long Flanking Sequence:
CACATTCACACACACACTACAGACAATTTAGCTTACCTAATTCACCTGTACCTGTGTGTTTGGACTGTGGGGGAAACCGGAGCACCCGGAGGAAACTCACGGGGAGAACATGCAAACTCCACACAAACTCCAAGAAGCCGAGGTTCGAACCAGCGACCTTCTTACTGTGAGGCGACAGCACTACCTACTGCGCCACTGCCTTGCCCCTTGGAGGAACTACTATGGTGAAAATATAATTCTGTTCACAGCAAAAACAGCACCTTATTTACTTGCTTAAACACATGGACATTTAAAGGGACAGTGCAGTTATGCCATTTTCTTTTCTAACATGACATCTTTATTAGATTTTACAGTAAATCAAGCCTCATTACCCTGAACACACCCCAGAAAGGTTTAGTGGGATATAATAAAATAAATGAGAACGAGAATGATAGCTGTTTAATATGCTTTTTAATACATGTTTCTGTTTACCTCATGAAGCGAGTTATATCAGCACCACT[C/A]GAACTGCAGCACAGGACGTGTTTTGTTCAGCACCGCCCAGCGCCTCTGCCAAATGCTGGAAGAAAACGTGCCCATGGTTTTACCTGAAAAGACGAACCTGCCTGCTGTCATTCACCGGCTGGCCTGCCAGGCAATTACAGTCTGCCACAGTGGTACACCTTCACTTATTATATTTCATTACAGCACACATCTCATAAAGCTTTATTATACAGCACTCAGCATAAATAAATACACCTCTAACAAATCTCTCTTTTAAACTCATATTTTCCATAGGATTCTTTACAATATTATATTTGTGCAAATACATTAGATTAGTCAGTACCAACTTAAACAAGTCTAACAAAATTACGTCACCCAAATTAATATGTTGGGGAAAATGTAATGATATATAATTTTGATTTCATAAACAGGACAAATCAAGAGAAACATGACATTTTGTAGCTTGTAATTAGTTTTTGCAATAACTCGTTTGAATTTAAATGTATTATATTTCTATTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31487
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 None None 522 None 16
ENSDART00000097285 None None 859 None 32
ENSDART00000124886 Nonsense 32 1025 2 27
Genomic Location (Zv9):
Chromosome 5 (position 69469985)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65795808
GRCz11 5 66474913
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGTATGTGTTTTCAAGGAATCTTCAATGAGTGGTGAAGAGGATGCGTA[T/A]GCCGAATCCCATTTTCACGATGTGTTCAATGAGGATGGCATTGTGCTAGA
Long Flanking Sequence:
CGATTGTGGTTTATTCGGGTGCAGAGATATTCAACAAGTCACTTGGTTTTCCAAAGAATGCCTGAAAAATACTGTATATTAGTGCTTTCAAATAATTGTAGTGAAAATTGCTTTCAGCTTTAATTTAGATGAGAAATAGTAGAAAACAATCATGTTATTAACTGGTAGGAAAATGTGTGCAAAACTAAGTTTTTTTTTAGTGTCTCATGTCAATTCAAATTTGTACAATGATTTCAATTAATTTCTGCCTACACTTTAAAAGATGCTGGGTTCCACACAATCAATTTGTGTTGGGGCAACATGAAGGAATTAAGTTAGCTTAAATGTTGTTACAAATTTAAGTGGATTGAACATAAAACAATTAAGTTAGATTGAATGTGAAAATGATCATGATTTAAATTAGATAATTTATTGATTTGTTTATATTTCAAAGGTTTTATTTTAATATCCACTGTATGTGTTTTCAAGGAATCTTCAATGAGTGGTGAAGAGGATGCGTA[T/A]GCCGAATCCCATTTTCACGATGTGTTCAATGAGGATGGCATTGTGCTAGATCCAGTTTCAGTGCTCCCGCTCCAATATAAAATCACCAGAAATTTGTTACCACTGTCAGGTAAGAGCTACAGTTGAAATGGCCATTTCACACACTCAGACTATCTTCTGAAAATAATAATACAACACTCTCATTAAAAACTGCTGTAAATATATGCTTGCTCATGGAAAAAAAGGTACTGTATACCAGGGGTTCCCAAACTTTTCAGCCCGCGACCCCCAAAATAACAATGCCAGTGACTCGCGACCCCCAATATCCTCTGACGTGGTTATAAATTCAGAAACCTTGCATGCAATGACGCAGACACACCAATAAAATTTGTGTCAGTGCTTAAAATGTACCAGAAAGTATAACCTGATGTTATAAAATCAAAATGCATGTGACGCTATTGCTGCCTTTAATATAATGTAATTACCCCAGGGGTCGCAATCCAATAGAACTAGTAACTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26620
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 None None 522 None 16
ENSDART00000097285 None None 859 None 32
ENSDART00000124886 Nonsense 429 1025 11 27
Genomic Location (Zv9):
Chromosome 5 (position 69478475)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65803404
GRCz11 5 66482509
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCCATAGACGAATATCTCCCCCCACTGACCTGGAGAGCTCATATCTTT[T/A]GGAAAACAGTCTTGAACCCACTGCTCTAGCTAACACTCGCTTGCCTTTTC
Long Flanking Sequence:
AACCAAACTTTTGAAAGTATTGAAGTACAAAGCAACTATGCACAAGCTTGTGCTTTCAGTCTCCTGTATTCGCTTGGGAATTAATGAAAGTCCATATACAGAAAATTGTTGAGTGACTGCAGTTTAACTAAGTATTTTCTTAAACGCATGTCAGTTTGTTGTTCCATCTTGTTTAGTAGAGTTTAACCTAATGGTATGCATTTTTTTTACTAATCTGAATGTGATCTGTACAGCTAAATCCATACAACTATGAGTGGATAGAACGAGTGCTTAAAACTATTCAGATGGCTGATGAGAGCACAACCCTTATACCTCTTGGTCAGGTAAGTCAATTTCCTGTAAAATATGTCATTCAGAAAAAAGTTTCATTATAAAATCTTGTATGGCTTAATGCTATTTGTGTCATGTGTGATTTATTTTTAAGATGGTGGGATTACTCCAGCACCTAAAGTCCCATAGACGAATATCTCCCCCCACTGACCTGGAGAGCTCATATCTTT[T/A]GGAAAACAGTCTTGAACCCACTGCTCTAGCTAACACTCGCTTGCCTTTTCATCTGCTCTTCCAGAGCAGCCATGCCTTCTGGAAAATTGTCTGTATGTATATCAGGGTGATGAAGGTTTTGCTGTTTAGCTCACTGAACTGTACTGTTCCCACAGTGGAGGGTAGATTACTTGCAGATTGATTGCATTTCAGATTACACGTACTGAAGGTGTAGTTAATTACTGTAGGTGTAGTTAGTAAACACAGTCTAGGTTACTCTTAGGAATTTACTGAAATTCAAGTTACTTTGTTTCTAACTTATTTAAAACACACCCTTAAACGTACCTTACTGATATAAATAAGAGAAATAAAATGTTGCATTTCTTGATAACATTTTCATAAAACTGAAATGTTACATTTACATCAGGGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33762
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 Nonsense 120 522 3 16
ENSDART00000097285 None None 859 None 32
ENSDART00000124886 Nonsense 681 1025 16 27
Genomic Location (Zv9):
Chromosome 5 (position 69489616)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65814374
GRCz11 5 66493479
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTAAAGATCCGGAATATTCTTCTGGAGAAGTGGTTATGTCAAACAGGG[C/T]AGTCTAATGGCAAGGTATGGATATGGTACTTTACCTAGGTTCATTTTTCT
Long Flanking Sequence:
CTAAAACTGAGCTAAAATTTACAGCAAATGTAAAAATAGCATTGAAATAAAAGCTATACAACCTTGGTATGGATAAACAGTACAGTATTTTCCTTATTCCTTTACTATTGTACCTTCATTGGTTTGAGACTTCCAGTTTCATTCACTTCAATTGATTTTAGTCGCAAGAAATGAACTGTTATTAACTGTTATTAACTGTTGTTGTTAAAAAAAAAGATAGTCTGTATCAATGTGTATGCTGGTGCATCAAACCCAAACACAACCAAAGCAATGTTGTATAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTAGAGACAGACTTTTTTTTGTTAACTCCACCCCCTTTTTCTGTAATTGATCAGATATTCATAGCGTGGCCAGCGAGATCGCCTCCATCAACAGTGTTGATCTTCTAAAGATCCGGAATATTCTTCTGGAGAAGTGGTTATGTCAAACAGGG[C/T]AGTCTAATGGCAAGGTATGGATATGGTACTTTACCTAGGTTCATTTTTCTAGACATCTTAACCATAAGTAAATGCAAATAGATAAGCTGTGATATCTCATGATGTTCTCTTTCCTCAATTCATTATAGCAAGGACTGTAAAATGCCAATTGACAGCCACTAGACATTATTGACAGGGTATTCGAGTGTCAGAATGCTGTGGGACTGCTGTACAGGAGTTATTAATAGGGATTATAGATCGGGAAGTCAAGCGTTTTTAAAAAAAAAAATTCATGACGGTAAAAAACACAAATGCGGTTATGAATATATTAAAACGTGTTCGTTTGTCATAAAAATTTGTAATAATGACAAAAAATACAATTTTGTGGATCTCCTTACTTCCGGGTTCAGCAATACTGCCGTTGTGGCTGGTGTATTCTGGGAAATTTTCTTACCCCTTGGTTTCAAGTGTGGTCCTGAAAAATCTTCGTTCGAAGGGCTATTCACCCCTTCCCCTTAGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26621
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 Essential Splice Site 169 522 5 16
ENSDART00000097285 None None 859 None 32
ENSDART00000124886 Essential Splice Site 730 1025 18 27
Genomic Location (Zv9):
Chromosome 5 (position 69491737)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65816490
GRCz11 5 66495595
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATATAAGTGCCCGTTTGCTCAGTCCTGTCCTGACTTCACAGACATGGG[T/A]AATCAGACTTTGTTGATCCTGTCGTTGCAAGTGCTTGGGAGGAGTGCAGA
Long Flanking Sequence:
CACCTACTCTAATGCACAATGCCTCTTTTTTAAAGTTTTACTGACTGCTTTTGGTGTTAGCTTTGGTATGTGGTAGCTTTGAATTCTGTGTACTGCTTATATGAAATGATTATCACATGTCATTTCTCCTGGTGAATTTACTCCGAAGGTTAATTATCAGACAAGACTTAAATTCATACCGTCTGTTTTGTAGGACATCAATCATCAGGACAATGTGACTGATGTAAATGATGATCCTGATCTCATGAGGTACCACTTCAAAATAAATATTAGTATTAGTAGTAGTAGTAGTAGTACAACTACTACTACACCATGTAATATCATGTAATGCTTTTTAGTGGATTAAAAAACATTTCTGTAACAGAAAGTCGTCTGATATCCCTGATATATATTTTTGCTTTCCTATTTTTTATTGTGCAGAGTTGTTTATTTGCTGCAGATGCACCCCATGGATATAAGTGCCCGTTTGCTCAGTCCTGTCCTGACTTCACAGACATGGG[T/A]AATCAGACTTTGTTGATCCTGTCGTTGCAAGTGCTTGGGAGGAGTGCAGAATCACTTCATCATAAATAGGTCTACAAAAGCATTCTGTGGTAAAGACAAACCGAACCGAGAAGAAACCTGAAGTGTTAGCCTGGGATTTCTTAAAAGTGTCAAATTACGGTTTTTACTAGGAAACTACATGGTATTTTGCTGTAAATGTATTGTAGGAGAACCACAGAGTTGGCAATGAGTCTTAAAGAGCCTTAAAGTTCCTAATTTACGGCTTTACAAAAAAATATGAATATATAAATATGTTTGTGAAATTACTGCAAAAATTTACTGCATTCTCCAGCAACTTTGATTAAAAAGTGTGTGAGGTAAGACAAGGTTCATTTAGGCAAATCTCCCTGACTAGTGCTCCTTAATCCATCATTTACTGTTAACCATCAAAATTAAAACGTTAAATTAGATTTAAATTAAATGATAGTGTGTATGTGGCCTTTAAAAAAACCCTCAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45236
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 Essential Splice Site 308 522 10 16
ENSDART00000097285 None None 859 None 32
ENSDART00000124886 Essential Splice Site 869 1025 23 27
Genomic Location (Zv9):
Chromosome 5 (position 69501367)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65825870
GRCz11 5 66504975
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTATATGAATTATTTCATTTAGTTTTTTATTTAATATTGTATTCCCAT[A/T]GGGACAAAGTCTTTCTAGAATTTGGCGGAGTGTGATTCAAGCCCCTTTCT
Long Flanking Sequence:
TTAAAATAACGCAGATAAATATCAAATACAGCGTTGACATAAAAATAAAATAAATCAACAGAATAAATAAATAACATCAAATAAGTGTATATGCATATTAAATAATAAATGTAAGTGATGTTAGTTAGTTACTGTAGTTTGAAAATAAATTAAGCCAAAACATGTACAAAAAAGGGTGGAGGGGTTTCCAAAATCATAGCCATAATTGTTATTTTGTCTCGTTACATGTTTTCTAGCATTGTGGGTCACAAAAATTCAGACTTTTTTTTTTTTTTGGCCTTTTTTAATGTTTTTTTTTTTTTTTTCTAAAGAGTTATAATTGTTTTGATTCAGTAAAGCAGCTTTGAAATGACATGTATAATGAAAAATACTTTACAACCACTTGATTTAAACTGATTTTATTTTAATTTGAAACAGTAGAGTTCAATAGAGGCAGTATAATATAATAAATCTTATATGAATTATTTCATTTAGTTTTTTATTTAATATTGTATTCCCAT[A/T]GGGACAAAGTCTTTCTAGAATTTGGCGGAGTGTGATTCAAGCCCCTTTCTTGACAGGTAAAAAAAGAAGATACTTAGACATGTGTCATTAATGTTGCACACAGATATTTCATTATTAATTTCATTATTTAATCCACAATTGTGTTACATTTATGTGCTTTTTACTGTTTGCCTTGATTATCATTTCACAGCCTCTCTTCCTCTCAGCCCTCAACAACACATGGTTATGTATAAGACATTTGTCTTGCTTTTGAAGTAAGTTGATGTATTTTTTTTCTTCTTTTAATAATGAGAAAAGTGTGGGGCTGATAGATTGTAAATTTATCAGGGAACTTGCTTATATGCATACAGATATGCGAGTTACACTTATTTTAAATTACATTTTATCTACAAAAGATTTGTGTGTTTTTTGGTGTAAATATAAAATGATTACCGATTTCTAGATCAGGGGTTCTCAAAGTGGGGGTCGCGGAACAATGACAAGGGGTCGCTTGGTGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2200
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 Nonsense 470 522 14 16
ENSDART00000097285 None None 859 None 32
ENSDART00000124886 None None 1025 None 27
Genomic Location (Zv9):
Chromosome 5 (position 69505925)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65830428
GRCz11 5 66509533
KASP Assay ID:
554-2506.1 (used for ordering genotyping assays)
KASP Sequence:
CGAAGGGTCGTTCTGAAGCAGTGCTGGAGCTGCTGAATTGCCTTGTGGAG[C/T]AAAAAGGGTTAGTTGGTCCTACGTCTAATTTTTAATAAATAATGTTGAAA
Long Flanking Sequence:
TTTTGAGGGTAATGCTTAGTTGTATTTTTGTTCAGTTTTCTCTAAATTCTCCCTTTTTACTTATCTGTGACCTGAATACTTTAGATTTCTGTTCAGTTTGTACAATACTAAAATAATATTTTGTTTGTTTTCTAAATCAGAGCTTCCTGTTGTCCTGTAATCCTACTCTTATTCTGGATCAGACCGAGGAAAGCATGGCTACCGGAGAGTTAGCTGGCATTCCTTCACAGGTTACCCCTATTATTCTGTTAAAACAAGTCTATTCTATACATTATACTATAGTCATTTAAAATGGCATACTACTACTAATGTTATGCATGCATGTATTTTTTCATGTGTTCTTTTATCTGCAGATTAGAGAGACAGTGTTTGCATTTCTTTGTCAAAACGGCAAATCCCAGACATTGCTGAAGACCAAACACTTCACTTATTTGAAGAGGCACTTGATCTCGAAGGGTCGTTCTGAAGCAGTGCTGGAGCTGCTGAATTGCCTTGTGGAG[C/T]AAAAAGGGTTAGTTGGTCCTACGTCTAATTTTTAATAAATAATGTTGAAACGCATACACAGTTTATACATTTAATTTAACAACATTTGTGTTACATAAAATTAAAGCTATTTTTTTGCACTCATTTCTAAATGTAACAGTTTTAAGAACTGATTCCTTTTATCTTTGCAATGATGAGAGCACATAATATTTGACTAGATGTTTTTCAAGATACTAGTATTCAGCTTAAAGTGACATTTAAAGGCTTAACCAGGTTAATTAGGCATGTTAGAGTAATTAGGCAAGTCTTTGTATAATGATGGTTTGTTCTGTAATCAAAAAATAAATACAGGGCTCAACAGTAAGGACTGCCTGATGGCCCGGGGTCAGCTTGAGAGATGCTTGGGATTGTTACTGGCCTGATATTTATATATTAGGGGTGTAACGATACACTCAGCTCACAGTACAATGTGTATCACGATATACTGTTCACGATTCGATGTGCATCACGATATTTGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9431
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 Nonsense 483 522 15 16
ENSDART00000097285 None None 859 None 32
ENSDART00000124886 None None 1025 None 27
Genomic Location (Zv9):
Chromosome 5 (position 69508448)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65832951
GRCz11 5 66512056
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGCTYTCTCTAAATAGTGAAGATGAGGCCMTTTSCTTTGCTAATGAATA[T/A]CTGCAAWRCCGARATCTGAAAGGAGAGAAAACGGCACCTGTGAGCGACCC
Long Flanking Sequence:
GTGGTATCGATATCGTTATTGTAAAAATGTTAACAAAAAGTATCGGTATCTTATCGAATTAAAAAATTGTGGTATCGCTCATTTCTAGTGTTGACTTGTGATGCATGTTATAGATTTTTATTAAAAACAAGTTATGTAATATCAATTGTTCCGGACCTTTGACCTTAATGTAGACTGCTATAATGCTGGTTTATGAAAAGTAAACATAATTGACTTAAAAAAAAAAAACATAACAATTCTTACTGTTTGTAGTGTGTGTGTTTGTGTGAGAATGAAATAGCCTTCAGTACAACTTTATAAAAGCGAGTGTGCCAGATGCCATTCACACACTTCAACGCTGTTGCTGTTTGTGTGAATTTTTCCCCATTGCAGTACGCCTGTGGTGCCAGCACCATGAAGTTTATTCCTGTTTCTAGCAAAAATAGAATTATTTATTTTTTTGCTATCTTTTTGCTCTCTCTAAATAGTGAAGATGAGGCCATTTGCTTTGCTAATGAATA[T/A]CTGCAATACCGAGATCTGAAAGGAGAGAAAACGGCACCTGTGAGCGACCCTTTCTCTGATCCTGTCAGGGTAACTCATCCTAAAGTTGACATTTTATTTGAATGAACAGATGTGTTTGTATGTATTTGATAAATCTTTGAAAGGAATGTTTATTGATGTTGTAGGTAAAAATGTTTTCTTTTTTCTTTTTTATTTTGACAGGACTTATTGGAAAAGGTGCTAGAATCCAGGGGTACTCAAACAGTGACCTAAGATTATTACATTTTTGTGTATACATCTTTGAGCAGTTTTGTAGTGTTTTCACTCAGTACAGTTCCACAAATGTTATGTGTTATTTTACACTGAGTATCATCACTATTATTGACAATATTCCAGTACTTATGTTTGATGGATTTAAACACAATTGTGAATGTTGGCACTTATCTGCTTCCCAAATAAAAATAACTGATATTGCCTTTTTCAATAATGTGAACATTTTTTGTGTACAATTTTTAAAAAGG
Associated Phenotype:
Not determined