Busch Lab

ZMP

tp53inp1

Ensembl ID:
ENSDARG00000028017
ZFIN ID:
ZDB-GENE-031018-3
Description:
tumor protein p53-inducible nuclear protein 1 [Source:RefSeq peptide;Acc:NP_001073505]
Human Orthologue:
TP53INP1
Human Description:
tumor protein p53 inducible nuclear protein 1 [Source:HGNC Symbol;Acc:18022]
Mouse Orthologue:
Trp53inp1
Mouse Description:
transformation related protein 53 inducible nuclear protein 1 Gene [Source:MGI Symbol;Acc:MGI:192660

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22919 Essential Splice Site Available for shipment Available now
sa10505 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22919
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038294 Essential Splice Site 42 241 3 4
Genomic Location (Zv9):
Chromosome 16 (position 43234104)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40618109
GRCz11 16 40568141
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATATATGCCACAACTTTCTATAACATCCTCTCTGTCGTCTGTTCCTGT[A/G]GCAAAGGCCTGCTCTGGTGCGTGTGGAGATGATCTGGAGGTTTGCCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10505
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038294 Nonsense 220 241 4 4
Genomic Location (Zv9):
Chromosome 16 (position 43235236)
KASP Assay ID:
2261-0159.1 (used for ordering genotyping assays)
KASP Sequence:
AGCAGCTGTCTCGCAACGCCTTGCGCCGCCTCAAYCTGSTGCGTGATGGS[G/T]GAGCYAGACAGGCTAAAGCCACCGGGGGCTACGTTCACCAGCCGGGACAG
Associated Phenotype:
Not determined