Busch Lab

ZMP

zgc:92869

Ensembl ID:
ENSDARG00000027984
ZFIN ID:
ZDB-GENE-040718-184
Description:
maleylacetoacetate isomerase isoform 1 [Source:RefSeq peptide;Acc:NP_001025442]
Human Orthologue:
GSTZ1
Human Description:
glutathione transferase zeta 1 [Source:HGNC Symbol;Acc:4643]
Mouse Orthologue:
Gstz1
Mouse Description:
glutathione transferase zeta 1 (maleylacetoacetate isomerase) Gene [Source:MGI Symbol;Acc:MGI:134185

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42995 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42996 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42995
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075529 Essential Splice Site 74 216 5 9
Genomic Location (Zv9):
Chromosome 17 (position 45273794)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44993595
GRCz11 17 45107360
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTGTCAGAAATTGTTTTAGGTTTACTTTTAGTTTTGCTATTGAACACA[G/A]TTGGCCATCATCCAGTACATTGAGGAAACCCGTCCAGAGCCCCGCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42996
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075529 Nonsense 112 216 5 9
Genomic Location (Zv9):
Chromosome 17 (position 45273909)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44993710
GRCz11 17 45107475
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGAGAGCTCATGTCCGCATCATCTGCGACATCATCGCCTCTGGGATC[C/T]AGCCTCTTCAAGTGAGTGAGACCAGACGGAATCTGAAATCACATACTTTT
Associated Phenotype:
Not determined