Busch Lab

ZMP

si:ch211-241d21.1

Ensembl ID:
ENSDARG00000027933
ZFIN ID:
ZDB-GENE-081105-172
Description:
Novel protein similar to H.sapiens GLIS family zinc finger [Source:UniProtKB/TrEMBL;Acc:B8JJK6]
Human Orthologue:
GLIS1
Human Description:
GLIS family zinc finger 1 [Source:HGNC Symbol;Acc:29525]
Mouse Orthologue:
Glis1
Mouse Description:
GLIS family zinc finger 1 Gene [Source:MGI Symbol;Acc:MGI:2386723]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31640 Nonsense Available for shipment Available now
sa10106 Nonsense Available for shipment Available now
sa38681 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31640
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029255 Nonsense 376 902 3 10
ENSDART00000140941 None None 226 None 3
Genomic Location (Zv9):
Chromosome 8 (position 18620877)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18065765
GRCz11 8 18101477
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTTCTCATACAGCCCGCTGCATTATTGGATGGCTGCACCCCAACGCTG[A/T]AACAAGAACCGGCGGATGAGTTCTCTCCAAGTGAGGAGGAGCTCTTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10106
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029255 Nonsense 450 902 3 10
ENSDART00000140941 Nonsense 32 226 1 3
Genomic Location (Zv9):
Chromosome 8 (position 18621099)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18065987
GRCz11 8 18101699
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCACCAGTACATGGGCTCCGGCCCAGGAGCCCTACTGCATCTTCAGAGC[C/T]AACAGCAGTCTCCACCCTCAGGCCTGCTGGCACAGCCCAAACAAACAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38681
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029255 Nonsense 716 902 7 10
ENSDART00000140941 None None 226 None 3
Genomic Location (Zv9):
Chromosome 8 (position 18684500)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18129388
GRCz11 8 18165100
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCAGGCCTGTACGCTGGCTCCAGCACGACACACAATGGAGCCCCACTT[G/T]AGTTGCTCTCTTCTGGACCTGACCTGCCACCCAGGCAGCCCCGCATGGAC
Associated Phenotype:
Not determined