Busch Lab

ZMP

zgc:92218

Ensembl ID:
ENSDARG00000027851
ZFIN ID:
ZDB-GENE-050102-4
Description:
hypothetical protein LOC494495 [Source:RefSeq peptide;Acc:NP_001009986]
Human Orthologue:
KIAA1407
Human Description:
KIAA1407 [Source:HGNC Symbol;Acc:29272]
Mouse Orthologue:
2610015P09Rik
Mouse Description:
RIKEN cDNA 2610015P09 gene Gene [Source:MGI Symbol;Acc:MGI:1922661]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa15499 Nonsense Available for shipment Available now
sa18526 Nonsense Available for shipment Available now
sa10497 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30084
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028542 Nonsense 118 892 4 16
ENSDART00000105938 Nonsense 118 892 4 17
Genomic Location (Zv9):
Chromosome 24 (position 21703314)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20950443
GRCz11 24 21094862
KASP Assay ID:
2261-8676.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGACGACGAGGAGGAAGAAGAGATCAGTTCCAGTACAATGGAGGATT[C/A]AGAATCCAAACAACTTATTAAGAACACAGAGTCCAGCTATAATAACTTTG
Long Flanking Sequence:
GAGCAAGTGGAAATGTTTTCTAACTGGGATATTTAAAATAAATCTTTAGCAATAAAGCCCTGTATATGTCTAAAGTTTCATTTATAATGGTCTTAAAAAGTCTTAAATTAAACTTAATAACCCTGTATGTATGAATGCATTTTTCTCTTGTAATCTTTCTCTTGCATTCTTCTTTTCCTCAGCGGGTGGAAAGGGCTTCAGAGTTTGCTGTATCTGAAGTGTTTTCATTGAAGAAACCCCATAATGGTAAAAAGATTATGCCACTGCAGAGTGTAGAGCAGCTACAGGATCATGATGATGCGTACAGCGAAGGTAGTCTTAATCTAATTAAAATTCAGCACTTTTTAAAAGTTATGACCATATTGATGGGTCATTATTCTCATACTCCACAGCTCAGTCTATTTTAAGTGAATGGATGAACCAGAAGTTACGGCTGGAGCTTGAAATGGATGATGACGACGAGGAGGAAGAAGAGATCAGTTCCAGTACAATGGAGGATT[C/A]AGAATCCAAACAACTTATTAAGAACACAGAGTCCAGCTATAATAACTTTGATGGTACAAATGGACAAATTACGCATTTTACAGGATGTTTACCTTAAATATCTACGGTCATTTAAAACAGTTATTTCCCATTTTATTAATACACTGTTGTAATATTTAATAATATTATACATTTTGTTTTTAGAATTTCAGTTTACATAATTTTTTAATATTTCTGTATAATGTGTTGTTTATGATTATTTTACAGTGATTTTGAGTGCATTCAGACATATTTTATTTCAGTTAGTTCATTTAAAATTATTATGGGCTCCATTATACAACATCCGAAAAACAAATAAAGCCGCAGGAGCTGAGTGAGGGAATGGCTTGTGACTTTTCAATTAGGGCTGGACGATTCGGCCTAAAATCAAAATATCGATTTATTGAACATTTTAACTCGATTTCCATTAATGAACGATTATTTTATTTATTTATTTTAAAAGTTTTGTAGAGAAAATATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15499
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028542 Nonsense 182 892 5 16
ENSDART00000105938 Nonsense 182 892 5 17
Genomic Location (Zv9):
Chromosome 24 (position 21705313)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20952442
GRCz11 24 21096861
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGATGGTGGAGAACCTCAAAGAGGACTCTGATCAGAGTAAGAAAAGGT[G/A]GAGGGACCCTAGCCTGACCATGGAGGTGCGGCACAAACAGGTAAAAGAGA
Long Flanking Sequence:
TGTGCATTTCAGACCATGCATTTAGATAGAGCACAATATGCCTAATTCAGAAATGTAATTATTTAGCAATACTGGTGGCGGTTAAGTCGATTGCAGACATTTTTAAATGTTTTCAGATGGTTTACTTTCTGCATCAGCATTATAAGCATTGGTTTTAAGTTTCGTCACAAGCTGAAGTATTCACACATTGGCACAAAAATATTCTTGTGTAAGCTTATTTGAAGATAATTATATATATATATATATATATATATATATATATATATATAAATTATAAATATTTATTTATTTATGTATTTATTTATTTATTCTTACAGATGACAGTATTAACATTGCAGCTCTTTTTATCTGTCTTTGTTTAGACTTGTACTTTCAACTAGAGCAGGAGGAGGAGAACTCTGTAGTGCATCATTTCCTCCAGGATTTGATGGAAACTGAGGTGTTGGACTTTGGGATGGTGGAGAACCTCAAAGAGGACTCTGATCAGAGTAAGAAAAGGT[G/A]GAGGGACCCTAGCCTGACCATGGAGGTGCGGCACAAACAGGTAAAAGAGAACCGCATGCGCAGAGATGCAGAGCATGAAAAACTGCGCAAAGAAAAAGAAGTGCTAAAGGAGGCGAGACAAGAAGTGCGGCAAATGGAACAGGAGAAACAGCGAAAGAAGAGACAGGAGGCTCAGCGGCAGGAGGAACTGATACAGCAGGAGATGATTCGCTTGCGCAGGGAGATGGAGAAGAAAAGGAATGTAGAGCAGCTGGCACGAAACATGTACAGCAATCACAAATACATGTGGACACACACTAGTAGTTACTATTAAAAATGCATAATTGTCAAAATATTAAAAAAAGTGGCATCTGCAAAGAAATTATGTTAGACTTTTTCCAGACTAACTTTATTTCTCAACTTTACTGCACACAAGGTGAGACTATGGAGTCGAGTTCATGTCAGGTTCATTCGAGGGCTTGATCAAAGGACTGTGGGGCTTTAAGGCAGTTGTATAATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8036
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028542 Nonsense 334 892 7 16
ENSDART00000105938 Nonsense 334 892 7 17
Genomic Location (Zv9):
Chromosome 24 (position 21707204)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20954333
GRCz11 24 21098752
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAAAARCATTTTTCTGCATGGTACTCTATGATACTGGAAAGAAGGGTA[C/T]GAATGGGYAAGGCAGCAGCGCTGTGTGATTGGAGGAGGCAGCTGAGGGCA
Long Flanking Sequence:
ATTGTGCTTTGAAAACATTGGTTTTGTTTTCTTTTAATGAATTAATTTGAAAAAAAAATTCTAATTCTTTAAAAATAGGTATATTTGGTCTGCAATTTTCATTTATAATTAGATCTAATAATACATTTTTAAATGTCCAGATTCCTCTTGGAGCTACTATAATTTTTTCATTTAAATGGCATGCTTATTTTTGAAAAGATAATTGCTTGACATTTAAATTTCATTTTTGAACAGGGAAAGAGAAAGGCTTCAGCAACAAAAGGCCACTAAGAGCTCTGTTATTCCAAAACATCATAATCCAACACAGAACAAAGAGCTTCAGCTCAAGCTGAAAAACCTAGAGGCTAAAATTCACCTCCTAAACCTGCAGGTAAGACAACAGCAGTTTAACCATCATTGTATGCAATGAACACTTTAATTTACGGACCTTACGCATACATTTCCAGCGCATGCAAAAACATTTTTCTGCATGGTACTCTATGATACTGGAAAGAAGGGTA[C/T]GAATGGGCAAGGCAGCAGCGCTGTGTGATTGGAGGAGGCAGCTGAGGGCATGGAGGGCCTGGAGAGCTCTGGTTTGGGCCAGAAGAGAGAAGAAAGAGGCTGAGAAGACTGAAGAAGAGCTGAGACATGAGCACAGGTAGCAGAGCTCAGTTTATCCACCTCTTTCCACACATGATTACTACATTTCTAACTATGTTTTGTACTTTTTCTGGTTTGGGGAACTTTCATTCAAAAACTTTACAAACATTACAAATAATCCATATCAGGGTTCGCAAAATTTCTAAATCTCTTGTAGCATTTCGGAAAGTAACTCTGAGTTTTTGGTAGCGCAAAATAATTTCCAGTACCCTGAGTAGAAAATACATTATTTATCAAATTAAAAAGAAATACATGCATTTAATAAATAAAAAAACTAAATATGATATCAAATAAGATATGATATATGTTGTTTTAATTATTTATTTATTTTTATTATTTTCTTAAATTGTCCTTGGGGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18526
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028542 Nonsense 562 892 9 16
ENSDART00000105938 Nonsense 562 892 9 17
Genomic Location (Zv9):
Chromosome 24 (position 21709737)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20956866
GRCz11 24 21101285
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAGCAGCAAGAGCAGATTCTGCTTCTGCAGGAGAGACAGAACATCCTG[G/T]AGCTCAGACGTGCAGAGGAGAAAATGGCTCTGATAGCAACAGGTTCCCCT
Long Flanking Sequence:
ACATGACACTTACGGCTGAAATATTCATTCATTCATTCATTTTCTTGTCTGCTTAGTCCCTTTATTAATCTGGGGTCGCCACAGCCGCAACAGCTGTTAGTAAAAAATTGTCAGAAATCGCTGGGTTAATTATTCCTGCTGGTGTATTTGGTAACATTGCAATCCTAAAAAATCTCTCTTGCTTCATCCCACCACAGGAAGGGCCAGCAACCCCAGACAGCGGTTCATCCACTGCTCAAGTCACTAACAGCAGTGGCCGCTCAGAGGCTCAGCTCACTCAGGCCTGGCAGGTGACACGTCGTCATGCTGCTCTCTCAATGGCTGAGCTCCGCCGGGCTCGTCAGACCCAGCAGAGCAGCAGAAGCAGAGGTGCAGAGCTCAGTGGTGGACAGTTCAAACACAGACACGCGGCCCTGCAGCAGACCGTTGCTGAGCAGAGACGCCTGCTGAAGGAGCAGCAAGAGCAGATTCTGCTTCTGCAGGAGAGACAGAACATCCTG[G/T]AGCTCAGACGTGCAGAGGAGAAAATGGCTCTGATAGCAACAGGTTCCCCTGAAGTCGTGAGCACATGCTGTCAGTCTAAAATTAACAAAGAAACAACAACTGGATGTGCAGAGAAACCAAGGTACACACATATGTGTCTGGGATTTATATCACACAAAAATCTAGAAAAATTCATTTATTCTAATTTTGCATAAAATCAAACCAAATCTCATACACAAACTTTATTGATGAAATGAAAAACAAAATAATTAATTAGCAAATATGAATATGTTTTTTTAAAATAAATGAACTAATAAAAAAAAGGTTTAAATCATCAGAAATTACATTTAGGAGGGTGTGCATTACATATGAATAATCGTCGGCTTGGATTGGTTGATCTTTTCCTTCATCTCATGCATTTAAATTCCTTTAGAGCACAGGTTTCAAAGCCAGTTCCTGGAGGGCTGCAGCTCTGCACAGTTTAGTTCCAACCCAACACACTTACCTGGAACTGGCCTTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30085
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028542 Essential Splice Site 656 892 11 16
ENSDART00000105938 Essential Splice Site 656 892 11 17
Genomic Location (Zv9):
Chromosome 24 (position 21715271)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20962400
GRCz11 24 21106819
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGGAAAGAGATGGAGGAGCTGAGGAGACACAAGCAGGAGGAGAAACTA[G/A]TAAGACCTGCTCATCTTCAGTGAAGGAGTCAAGAGAACATGATGATGAAA
Long Flanking Sequence:
GTTCTAAACACTAAGCCACCATGTCGCTATCAAAATATTAATATATAAATAATAAAAGAGTAAGCATTCATTATATACTGTAATAGGATTGTATATTTTAAAACAAACAAAATGCTGCACAGGGTGGTTTTTCTTCACATGTTTAATACTGGGAACCAACTTTGCCTTAAGCCAAGGCTAATTTCCTAATCCTTATTCCAAGCATTGAAAAATCCTGCAACCAGCAGTGAGATTTTGAGCAAAAATACTCAGTTGGCTTGATATAAGACATGGCCTTGAATACAGATGCAAAAGCAAAAGAAACATGTACCAAAGAGCCATAAGATCTTAAGAACATGCTGCAATACTTCACAGTGACCCTTTAATCTCGGTCTCCCGCCAACTCTGTCTCTCGTTTCTCTTTTATGGTTCTTACAGCCATGGAGGAGCGAGCACGTCTGCGCGCTGAACGCAGGAAAGAGATGGAGGAGCTGAGGAGACACAAGCAGGAGGAGAAACTA[G/A]TAAGACCTGCTCATCTTCAGTGAAGGAGTCAAGAGAACATGATGATGAAAGCATCATATTTTTGCTTCATCAGGCTCAAATGAAGGCCGCTGAGGAGGAAAGACTGAGAGCTGAGGAAGAGGAGAAACAAAGGGAGGTGGAGAGGAAGAAGGAAGAGAAGAGGCAACAGAAGAAGGTGTGTGGAGAATACTCATATCATCAGGGTTTCCCTGGGGTCATAAAATGTCTTAAATCTCAAAAGCTAAATTTTAGGCCTTAAATCTACTTAAATGTTGTGGTGTAGGTCTTAAATCTTTTTTAACAGGTCTAAATATTCCTGTTAACTTCTTTTTTTCTTAATTTTATTATAGTTATAGACTGAAGTAACTGACAGCTATGTTTTGTTCTGTTCTTGGTAAGGGTTATAGAGTTTGTCATGGATATATTTGAAAATTAATTTAAAAAATATTCAAAAATTATTATTAAAGAACAAAAAACTAAATTGTTATTATTGTATTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10497
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028542 Nonsense 833 892 15 16
ENSDART00000105938 Nonsense 833 892 15 17
Genomic Location (Zv9):
Chromosome 24 (position 21725371)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20972500
GRCz11 24 21116919
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACTGCTGGATCACATGACAGAAGAGAGGATAWYAGCCTGGGATGATGAG[C/T]AGCGGGCACAACAACACAACAACAGGTCAACAAACATACAGCTTTATGTT
Long Flanking Sequence:
CCACCAGGGCTATGTAACTGGCAAGATGTTCAAGATACTGACCAAAGCAGAAAGTGTGCACTGCCAGTTTATATACCCAATTTTAATGTTTAGTGTTAGCAAAGTTTATAAACATTCATTCATTCATTTTCTTGTCGGCTTAGTCCCTTTATTAATCCGGGGTCGCCAGAGTAGAACGAACCGCCAACTTATCCAGCAAGTTTTTATGCAGCAGATGCCCTTCCAGCCGCAACCCACCAGCGACCTTGAAGTGAGGCGACAGCACTACCTACTGCGCCACTGCTTCGCCTTAATAAACATTTTTTATACCCAATTTTAATGTTTAGTGTTAGCAAAGTTAATAAACAATTTTTTTCTCCAATACTTGTCAGTTAAAAGATGTGCGCTTTATACTGGAAGCACGAGCCGAGCATTTCTACAAGACAAACATTCAGAGGAAAATGTTGACAGCACTGCTGGATCACATGACAGAAGAGAGGATAACAGCCTGGGATGATGAG[C/T]AGCGGGCACAACAACACAACAACAGGTCAACAAACATACAGCTTTATGTTGCTTTCCTTCACCTTTGTTGCCATTAGGCTGAGGCTACAGGTTACACTGGGACATTTTCATTTGAACACAGTATTTTACATGATCAAAATGATCATTTTGATTATCATTGTCCATCTTTTTTAGTATTTCAGGAAAAAAAATCTCCATCCATACTACATGAGCGGAAACGTGTCAGATACTAAAACAAGCTTTAAAAATGTAGTACAAAATTGCTGTTTTTTTATTTTTTGATGAAATTGTTTATTAATCCCAAAATACTTAAAAGTATTTAGTATTAAAAATAGCCTTTATTATTCAAACTAAAATGGTTTGGAGGATCAAACATTCTAGAGTAGTGTGGATGTCAGACATAATTATAGAAAATGTTGTGTTTTAAACAAAAACACAATTTTGTCAATGATGTAGCCAGAATCTATCAGCAGTTTTTAAGCACCATAAGTCTATAAATC
Associated Phenotype:
Not determined