Busch Lab

ZMP

grin1a

Ensembl ID:
ENSDARG00000027828
ZFIN ID:
ZDB-GENE-051202-1
Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 1a [Source:RefSeq peptide;Acc:NP_001070182]
Human Orthologue:
GRIN1
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 1 [Source:HGNC Symbol;Acc:4584]
Mouse Orthologue:
Grin1
Mouse Description:
glutamate receptor, ionotropic, NMDA1 (zeta 1) Gene [Source:MGI Symbol;Acc:MGI:95819]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa133 Nonsense Confirmed mutation in F2 line Not yet available
sa37246 Nonsense Mutation detected in F1 DNA Not yet available
sa25151 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa7245 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa133
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041869 None None 226 None 4
ENSDART00000102368 Nonsense 469 901 11 20
ENSDART00000126045 Nonsense 469 938 11 21
ENSDART00000129744 Nonsense 469 966 11 23
Genomic Location (Zv9):
Chromosome 21 (position 9915516)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11398879
GRCz11 21 11491507
KASP Assay ID:
554-0070.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGAAATTTCACTTTTTCTGGTTTGGTTACAGGACGCCCAATTGTACCC[C/T]AATGTTGCTACGGATTTTGCATTGACCTTCTGATCAAGTTGGCTTTAACT
Long Flanking Sequence:
GCCTATATAAAATACAGGTAAAGTGTGAAAGTAAATATGGAAGGATTGTACTTCTTTTAGATGCTAATGCTCCACTCTAGCTGTTCATAACAAGAACTCATAACAGACAAGAAAATGCATCCATTCTGACCACAAGAGTTGTGGCTACAGTACAGTTCTTTAATTCAGCAAGTACTATAGATGAATTGAAAATTAATTCCCAAAGTTTTTTTTATATTTTATTCAGTTATCATTTGCAAATCTCTGACTGGGCGAGTAGAGAAAAGGCTAAATTAATTTGAAATGGAATTGGTGAGAACTTAGTGCTGACTAGCAGTTGAGAGCACTGCCATCTAAAATAGAAACATACAATCTGTAAAGGAGTGAATGATTTTAGTATTGGGTTGAGAGGAGAGTGAGTGATGGGCTTTCCAACTATAGAGTGTTCCACTTGCAACTTTATCAAGATGGAATGAAATTTCACTTTTTCTGGTTTGGTTACAGGACGCCCAATTGTACCC[C/T]AATGTTGCTACGGATTTTGCATTGACCTTCTGATCAAGTTGGCTTTAACTATGAACTTTACCTATGAAGTACACCTGGTGGCAGATGGAAAATTCGGGACGCAGGAAAGAGTAAGTATAATTTTACAGTGCGTGAAGTATAAGCAGCATGATTACCATATGAAAAATTCATAATTACTTTATATTTTCATTTTGTGATATAGGTTAATAACAGTAACAAGAAGGAGTGGAATGGTATGATGGGTGAGCTCCTGGGTGGCCTTGCTGACATGATCGTTGCTCCCTTGACGATCAACAATGAACGAGCCCAGTACATAGAATTTTCCAAGCCTTTCAAATACCAGGGACTCACTATCCTTGTGAAAAAGGTACGATTACACCACTTAAACTACCACATTCTATCATGACAGCACTGCCAAAAAGATCAGCATTGCTAGTATCTTTCAAAGGAGGTGCTGAGGCAATGAGCTTTGCTAAATATATGTAAGTGACCATGCAATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa338
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041869 None None 226 None 4
ENSDART00000102368 Nonsense 473 901 11 20
ENSDART00000126045 Nonsense 473 938 11 21
ENSDART00000129744 Nonsense 473 966 11 23
Genomic Location (Zv9):
Chromosome 21 (position 9915528)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11398891
GRCz11 21 11491519
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTTTCTGGTTTGGTTACAGGACGCCCAATTGTACCCCAATGTTGCTAC[G/T]GATTTTGCATTGACCTTCTGATCAAGTTGGCTTTAACTATGAACTTTACC
Long Flanking Sequence:
TACAGGTAAAGTGTGAAAGTAAATATGGAAGGATTGTACTTCTTTTAGATGCTAATGCTCCACTCTAGCTGTTCATAACAAGAACTCATAACAGACAAGAAAATGCATCCATTCTGACCACAAGAGTTGTGGCTACAGTACAGTTCTTTAATTCAGCAAGTACTATAGATGAATTGAAAATTAATTCCCAAAGTTTTTTTTATATTTTATTCAGTTATCATTTGCAAATCTCTGACTGGGCGAGTAGAGAAAAGGCTAAATTAATTTGAAATGGAATTGGTGAGAACTTAGTGCTGACTAGCAGTTGAGAGCACTGCCATCTAAAATAGAAACATACAATCTGTAAAGGAGTGAATGATTTTAGTATTGGGTTGAGAGGAGAGTGAGTGATGGGCTTTCCAACTATAGAGTGTTCCACTTGCAACTTTATCAAGATGGAATGAAATTTCACTTTTTCTGGTTTGGTTACAGGACGCCCAATTGTACCCCAATGTTGCTAC[G/T]GATTTTGCATTGACCTTCTGATCAAGTTGGCTTTAACTATGAACTTTACCTATGAAGTACACCTGGTGGCAGATGGAAAATTCGGGACGCAGGAAAGAGTAAGTATAATTTTACAGTGCGTGAAGTATAAGCAGCATGATTACCATATGAAAAATTCATAATTACTTTATATTTTCATTTTGTGATATAGGTTAATAACAGTAACAAGAAGGAGTGGAATGGTATGATGGGTGAGCTCCTGGGTGGCCTTGCTGACATGATCGTTGCTCCCTTGACGATCAACAATGAACGAGCCCAGTACATAGAATTTTCCAAGCCTTTCAAATACCAGGGACTCACTATCCTTGTGAAAAAGGTACGATTACACCACTTAAACTACCACATTCTATCATGACAGCACTGCCAAAAAGATCAGCATTGCTAGTATCTTTCAAAGGAGGTGCTGAGGCAATGAGCTTTGCTAAATATATGTAAGTGACCATGCAATGTGTGTTTCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37246
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041869 None None 226 None 4
ENSDART00000102368 Nonsense 547 901 12 20
ENSDART00000126045 Nonsense 547 938 12 21
ENSDART00000129744 Nonsense 547 966 12 23
Genomic Location (Zv9):
Chromosome 21 (position 9915842)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11399205
GRCz11 21 11491833
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCTCCCTTGACGATCAACAATGAACGAGCCCAGTACATAGAATTTTCC[A/T]AGCCTTTCAAATACCAGGGACTCACTATCCTTGTGAAAAAGGTACGATTA
Long Flanking Sequence:
TGCCATCTAAAATAGAAACATACAATCTGTAAAGGAGTGAATGATTTTAGTATTGGGTTGAGAGGAGAGTGAGTGATGGGCTTTCCAACTATAGAGTGTTCCACTTGCAACTTTATCAAGATGGAATGAAATTTCACTTTTTCTGGTTTGGTTACAGGACGCCCAATTGTACCCCAATGTTGCTACGGATTTTGCATTGACCTTCTGATCAAGTTGGCTTTAACTATGAACTTTACCTATGAAGTACACCTGGTGGCAGATGGAAAATTCGGGACGCAGGAAAGAGTAAGTATAATTTTACAGTGCGTGAAGTATAAGCAGCATGATTACCATATGAAAAATTCATAATTACTTTATATTTTCATTTTGTGATATAGGTTAATAACAGTAACAAGAAGGAGTGGAATGGTATGATGGGTGAGCTCCTGGGTGGCCTTGCTGACATGATCGTTGCTCCCTTGACGATCAACAATGAACGAGCCCAGTACATAGAATTTTCC[A/T]AGCCTTTCAAATACCAGGGACTCACTATCCTTGTGAAAAAGGTACGATTACACCACTTAAACTACCACATTCTATCATGACAGCACTGCCAAAAAGATCAGCATTGCTAGTATCTTTCAAAGGAGGTGCTGAGGCAATGAGCTTTGCTAAATATATGTAAGTGACCATGCAATGTGTGTTTCAGGAAATTCCTCGCAGTACGCTGGACTCGTTCATGCAGCCTTTTCAAAGCACCTTGTGGCTACTGGTGGGTCTGTCGGTACATGTGGTGGCGGTGATGCTTTACCTATTAGACCGGTTCAGGTACAACTTGACGTTGGGTTGAGAGCGATGCTAGCTTTTTCATGCGTGTTCATGGGGTGCCATCTTTGCATGTTTTTTGTTCTATTTAGATTTGTTTCACTCATCGGGATCATACAGTACCTTTCAGGATGTCTCAACAGTACAAGAGAGTGTTAAACATGTTACATTGTCAGTGTTGCCATTGAGCCTGTTCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25151
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041869 None None 226 None 4
ENSDART00000102368 Essential Splice Site 688 901 16 20
ENSDART00000126045 Essential Splice Site 688 938 16 21
ENSDART00000129744 Essential Splice Site 688 966 16 23
Genomic Location (Zv9):
Chromosome 21 (position 9916974)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11400337
GRCz11 21 11492965
KASP Assay ID:
554-7688.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCACCAAAGAAAAGGTTTTTAAGATTTATAAAACAAGTTTGCTTTTTTC[A/C]GCTGAGGAACCCATCAGACAAATTCATCTATGCCACAGTGAAGCAGAGTT
Long Flanking Sequence:
TGCTAGATCATACTTTTTAGGACTACTTACTGTAGTGGAGCTTTTTCTGATTATTTGCACTTTTTCCATCTGGTTTTCTCAGCCCATTTGGAAGGTTTAAAGTAAACAGCGAAGAAGAAGAAGAAGATGCCCTCACCTTATCTTCAGCTATGTGGTTTTCTTGGGGTGTCTTGTTGAACTCTGGAATTGGAGAAGGTGTTGACAAACTTTGTTTCTGATGATGTTCAAATTAAATCAGTTGACATTTGACACATATTTGACTACTTGCATGTTGTCTAGGTGCCCCACGTAGTTTTTCAGCAAGAATATTAGGAATGGTGTGGGCTGGCTTCGCTATGATTATAGTAGCATCCTATACTGCCAACCTGGCTGCCTTCCTAGTGTTGGACCGGCCTGAGGAGCGCATCACCGGCATCAACGACCCAAGGGTACGCTTCTCTTTGTACCTGAACCACCAAAGAAAAGGTTTTTAAGATTTATAAAACAAGTTTGCTTTTTTC[A/C]GCTGAGGAACCCATCAGACAAATTCATCTATGCCACAGTGAAGCAGAGTTCGGTGGATATTTACTTCCGGCGACAAGTTGAGCTGAGCACCATGTACCGCCACATGGAGAAGCACAACTACGAGAGCGCCGCTGAAGCCATCCAGGCCGTTCGGGACAAGTGAGTCCCTGTTGGGTAGACACTGGCAGGTCTGACCTTATGGTCTGTCAATCAGTCACTCGATCATAAGGGTCCTGGGCCTGCAGGTCTCAGGTAAATTAATCAGTGTCAGCACTTACTGCACTAACCTGTGACCCTGGCCCATAGCCCAGCACAGGAGAGGCCCAGCTATGTGCCACACATAACGTTTATTAACAATAAGCTAAAGAACACCTTTTTCAGGTTTTCAACAAAAACGTCTTTGAGGGAATCCAATGGGGGACAAAGCTCCACTCGTCCGGCATTGGATTTCATTTGCCTATGAGGTGGCAGTCTAGATTTCTGGTAACACAAGTTGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7245
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041869 None None 226 None 4
ENSDART00000102368 Essential Splice Site 831 901 18 20
ENSDART00000126045 Essential Splice Site 831 938 18 21
ENSDART00000129744 Essential Splice Site 831 966 18 23
Genomic Location (Zv9):
Chromosome 21 (position 9918127)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11401490
GRCz11 21 11494118
KASP Assay ID:
554-5128.1 (used for ordering genotyping assays)
KASP Sequence:
GACTCAAGGAGCAATGCCCCAGCCACACTCACCTTTGAGAATATGGCAGG[T/G]ATGGTCCATTTCAGGTACAGAGTAACCTAAAAGAGATTGGACAAAAAAGG
Long Flanking Sequence:
GAGTTTGAAGCCTCGCAGAAGTGCGACCTGGTGACCACGGGAGAGCTGTTTTTCCGTTCGGGCTTTGGCATAGGCATGCGCAAGGACAGCCCCTGGAAACAGAATGTGTCCCTGGCTATTCTCAGGTCTGTCCCAGCCGAAGCAGCATTTTGTACGCTTTCGTAGTTTCATGTTGTATAAAATCTCATCATTTGGACACTTATTCATCTATCTCTGTGTACTTCCCCTCTCCCATCCCTGCTCTGTTGTCTGTGCTGGAACATATATGCGTTTGTGTTTGTGTATGTCCTTGTGGTTGTGGTGACTTTGTGGGATTAATCGGTACTTTCCAACGAAAGCAACTTATTAACTTTTTAACTTCTTTTCCTGCTCTCCACTACCCCTTGCAGTTCCCATGAGAATGGCTTCATGGAGGACCTAGATAAAACCTGGGTGAGATACCAGGAGTGTGACTCAAGGAGCAATGCCCCAGCCACACTCACCTTTGAGAATATGGCAGG[T/G]ATGGTCCATTTCAGGTACAGAGTAACCTAAAAGAGATTGGACAAAAAAGGTACAGTAGGTAAGATATCGGGACCTTATTTTGTCCAATGCTTTTAGTTGTTTTTAGTTTAATGCTCACCTGTGTTGGTCTCCATAATTTTAACAAACTCATTAATCTTTAACATCCATCCATTTTGCATGGTTTTCAGCAGGTCTTAAATATATGGGCAATACATGTAGGATTCCATCACACAGAGGCTCCACCCTTTTCCAGCTCCTCAATGGGTTGATTCAAATAACATTGTAGTGTACTTCATCTGACGGTTTTATTCATCCCTCTCTTTCACAGGGGTCTTCATGCTAGTTGCTGGAGGCATTGCAGCAGGAATATTCCTCATCTTTATCGAGATTGCATATAAGCGCCATAAAGACGCCCGCAGGAAGCAGATGCAGCTAGCCTTTGCGGCCGTCAATGTCTGGAGGAAGAACCTACAGGTAAGGTAGTTCTCTTCTACAACACA
Associated Phenotype:
Not determined