Busch Lab

ZMP

si:ch211-274c22.6

Ensembl ID:
ENSDARG00000027777
ZFIN ID:
ZDB-GENE-081107-35
Human Orthologue:
TNFAIP3
Human Description:
tumor necrosis factor, alpha-induced protein 3 [Source:HGNC Symbol;Acc:11896]
Mouse Orthologue:
Tnfaip3
Mouse Description:
tumor necrosis factor, alpha-induced protein 3 Gene [Source:MGI Symbol;Acc:MGI:1196377]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa22193 Nonsense Available for shipment Available now
sa35393 Nonsense Mutation detected in F1 DNA Not yet available
sa35394 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa22194 Nonsense Available for shipment Available now
sa10832 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22193
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033528 Nonsense 33 762 1 8
ENSDART00000147959 Nonsense 28 756 1 8
Genomic Location (Zv9):
Chromosome 13 (position 1054254)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1052062
GRCz11 13 1182353
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTCCTGAAGGCGGTCAAAATCAGAGAGCGGGTGCCCAATGATGTGGTC[A/T]AACCCTCGGCAGGCGGCAGCCTGATCCATCACCTGCGGAGCATGCACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35393
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033528 Nonsense 248 762 4 8
ENSDART00000147959 Nonsense 243 756 4 8
Genomic Location (Zv9):
Chromosome 13 (position 1073970)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1071778
GRCz11 13 1202069
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGGGAATATACCTGCCTTTGCATTGGCCTCCAGGTGAATGCTACAAATA[T/A]CCCATAGTGCTCGGCTACGACTCGCAGCATTTTGCACCCCTGATCACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35394
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033528 None None 762 None 8
ENSDART00000147959 Splice Site, Nonsense 311 756 6 8
Genomic Location (Zv9):
Chromosome 13 (position 1076920)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1074728
GRCz11 13 1205019
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGTTTAAATCCAATTAATCATGATTAACACCACTAAACCTAAAATCTAG[C/T]AGCACGTTTGCCTTTTTAAAATCTCGAATGCTTTTTCCTCCAGACTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22194
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033528 Nonsense 355 762 6 8
ENSDART00000147959 Nonsense 349 756 6 8
Genomic Location (Zv9):
Chromosome 13 (position 1077036)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1074844
GRCz11 13 1205135
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGATATGAACCTGATGGAGGATTACCTGCAGCTGGTGAACCACGAGTA[C/A]AAGCGCTGGCAGGAGGACAAGGACTCTCTCTGGGCCCCGCAGTCCCAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10832
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033528 Nonsense 570 762 6 8
ENSDART00000147959 Nonsense 564 756 6 8
Genomic Location (Zv9):
Chromosome 13 (position 1077679)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1075487
GRCz11 13 1205778
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCAGCAGGAGCCCAGGACGGAGGGTTCGGTSTGGGCAGAACGCAGTGGG[C/T]AGACCTGGCAGACGCCCGCRGCCMGACAGTGCAAACGCTCTGGATGCCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7711
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033528 Essential Splice Site 608 762 6 8
ENSDART00000147959 Essential Splice Site 602 756 6 8
Genomic Location (Zv9):
Chromosome 13 (position 1077797)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1075605
GRCz11 13 1205896
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAGCTGGGATTCTGCACCATATGCTATCTAGAYTACCAGACCAATCACC[G/A]TGAGTGTTTTACGTAATATTGTCATGATAGTGGAATTTACAACTTCGATA
Associated Phenotype:
Not determined