Busch Lab

ZMP

zgc:56116

Ensembl ID:
ENSDARG00000027600
ZFIN IDs:
ZDB-GENE-040426-908, ZDB-GENE-040426-908
Description:
PDZ and LIM domain 5 isoform 2 [Source:RefSeq peptide;Acc:NP_956490]
Human Orthologue:
PDLIM5
Human Description:
PDZ and LIM domain 5 [Source:HGNC Symbol;Acc:17468]
Mouse Orthologue:
Pdlim5
Mouse Description:
PDZ and LIM domain 5 Gene [Source:MGI Symbol;Acc:MGI:1927489]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa11364 Essential Splice Site Available for shipment Available now
sa34802 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11364
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036090 Essential Splice Site 521 628 10 12
ENSDART00000098750 None None 197 None 7
Genomic Location (Zv9):
Chromosome 10 (position 1201734)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 1196456
GRCz11 10 1191145
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTTGGTCCACANGAAGAGTTGWTGCTAATCTTCAGCTTTATCTGCTAAC[A/T]GGAAGTCATCAATGCCCTGAAGCAAACCTGGCATGTGAACTGCTTCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34802
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036090 Essential Splice Site 561 628 10 12
ENSDART00000098750 None None 197 None 7
Genomic Location (Zv9):
Chromosome 10 (position 1201610)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 1196332
GRCz11 10 1191021
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAACAACACCTTCCACCTGGAGGACGGACAGCCGTACTGCGAGAAAGG[T/A]CCAGAAACGCACACAATACTCAAATATAATGATTTAGCTTCTACACAATT
Associated Phenotype:
Not determined