Busch Lab

ZMP

si:dkey-106m10.4

Ensembl ID:
ENSDARG00000027523
ZFIN ID:
ZDB-GENE-091113-40
Human Orthologues:
AC008661.1, TRPC7
Human Descriptions:
short transient receptor potential channel 7 isoform 1 [Source:RefSeq peptide;Acc:NP_065122]
transient receptor potential cation channel, subfamily C, member 7 [Source:HGNC Symbol;Acc:20754]
Mouse Orthologue:
Trpc7
Mouse Description:
transient receptor potential cation channel, subfamily C, member 7 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa5584 Essential Splice Site F2 line generated Not yet available
sa2570 Essential Splice Site F2 line generated Not yet available
sa34888 Nonsense Mutation detected in F1 DNA Not yet available
sa15708 Essential Splice Site Available for shipment Available now
sa9272 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30937 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34889 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5584
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063619 Essential Splice Site 321 861 2 12
ENSDART00000138703 Essential Splice Site 312 842 2 11
ENSDART00000063619 Essential Splice Site 321 861 2 12
ENSDART00000138703 Essential Splice Site 312 842 2 11
Genomic Location (Zv9):
Chromosome 10 (position 21491122)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21452536
GRCz11 10 21409917
KASP Assay ID:
554-3394.1 (used for ordering genotyping assays)
KASP Sequence:
GCCCTGCCTTAGCCGTGTTAAACTGGCCATTAAGTATGAAGTCAAAAAGG[T/C]ACTGGGAAATRAAACATRCACTATAAAGCCCAAAANTTAAGGTAACTCMAA
Long Flanking Sequence:
AGACGATCACTTTCGACAGTTGTAATGGCGTGTCAGTGATTCCGCCTCTGTAGTTCCACATAAAATGTTTGTTGTTTTAAAACAATGCCGCGCTATAATTAGCAGGACGAGTTTCTCTTGGGTGCCCTCCATTAGGTAAAATCTCAGTTTGAGAAGATCTGATGCAAACGTCAATCAGACAGTGGTGCAACATGGGATTTTTAGACGTTTCAGAGCTGAGCGTTCACTCTTAGTTGTATCCCAATTGGGTTAAATTAGTTTTTATGAGTGATTAAAAGCCATTCTGGCGTAATTCTGTCGCTCTTTTTGCTTTCAGAATGACTATAGGAAGCTCTCCATGCAGTGTAAGGACTTTGTGGTTGGCGTTCTGGATCTGTGCCGGAATACAGAGGAAGTCGAGGCAATTCTGAATGGAGATGTGGATCAGAATCATCCAAGCGAACACCATCGGCCCTGCCTTAGCCGTGTTAAACTGGCCATTAAGTATGAAGTCAAAAAGG[T/C]ACTGGGAAATGAAACATGCACTATAAAGCCCAAAATTAAGGTAACTCAAACCCTTTGAGGAATCTGATTGCAACAAACCATTTAAGTTCAAAAACTAATTCTAATGAGTACTGTGAACTTAATCCATTTGAGTAAATGAAGCAATTTGAGCACAGTGAAACCCAATAAATGAAGAGAACTCAAATCATCTAAGTACTGTAAAACTCATTAAGTTAAGGCAACTCAAACTGTCCATTTGAGTTAAAAAAAACTAATCTATATGAGTGCTGTGAACTTACTCCATTTAAGTTAAAATAATGAGGTATTTAACAAATGAATAGAATTAACTTTTAGTCGATTTTGAGTTAACTACACTCAATTCATTTGATAAAGTTGACTGTTGGGTTTTACAGTGTAGGTTTAAATATAGGAGTCCAGATATAAAAAATCAAAGCCCAGATATACTTTAAGAAACTGTGAGGATCAAAATATATTCCAAGACTCAGGATGATTCCTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2570
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063619 Essential Splice Site 321 861 2 12
ENSDART00000138703 Essential Splice Site 312 842 2 11
ENSDART00000063619 Essential Splice Site 321 861 2 12
ENSDART00000138703 Essential Splice Site 312 842 2 11
Genomic Location (Zv9):
Chromosome 10 (position 21491122)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21452536
GRCz11 10 21409917
KASP Assay ID:
554-3394.1 (used for ordering genotyping assays)
KASP Sequence:
GCCCTGCCTTAGCCGTGTTAAACTGGCCATTAAGTATGAAGTCAAAAAGG[T/C]ACTGGGAAATRAAACATRCACTATAAAGCCCAAAANTTAAGGTAACTCMAA
Long Flanking Sequence:
AGACGATCACTTTCGACAGTTGTAATGGCGTGTCAGTGATTCCGCCTCTGTAGTTCCACATAAAATGTTTGTTGTTTTAAAACAATGCCGCGCTATAATTAGCAGGACGAGTTTCTCTTGGGTGCCCTCCATTAGGTAAAATCTCAGTTTGAGAAGATCTGATGCAAACGTCAATCAGACAGTGGTGCAACATGGGATTTTTAGACGTTTCAGAGCTGAGCGTTCACTCTTAGTTGTATCCCAATTGGGTTAAATTAGTTTTTATGAGTGATTAAAAGCCATTCTGGCGTAATTCTGTCGCTCTTTTTGCTTTCAGAATGACTATAGGAAGCTCTCCATGCAGTGTAAGGACTTTGTGGTTGGCGTTCTGGATCTGTGCCGGAATACAGAGGAAGTCGAGGCAATTCTGAATGGAGATGTGGATCAGAATCATCCAAGCGAACACCATCGGCCCTGCCTTAGCCGTGTTAAACTGGCCATTAAGTATGAAGTCAAAAAGG[T/C]ACTGGGAAATGAAACATGCACTATAAAGCCCAAAATTAAGGTAACTCAAACCCTTTGAGGAATCTGATTGCAACAAACCATTTAAGTTCAAAAACTAATTCTAATGAGTACTGTGAACTTAATCCATTTGAGTAAATGAAGCAATTTGAGCACAGTGAAACCCAATAAATGAAGAGAACTCAAATCATCTAAGTACTGTAAAACTCATTAAGTTAAGGCAACTCAAACTGTCCATTTGAGTTAAAAAAAACTAATCTATATGAGTGCTGTGAACTTACTCCATTTAAGTTAAAATAATGAGGTATTTAACAAATGAATAGAATTAACTTTTAGTCGATTTTGAGTTAACTACACTCAATTCATTTGATAAAGTTGACTGTTGGGTTTTACAGTGTAGGTTTAAATATAGGAGTCCAGATATAAAAAATCAAAGCCCAGATATACTTTAAGAAACTGTGAGGATCAAAATATATTCCAAGACTCAGGATGATTCCTTTTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4370
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063619 Nonsense 695 861 8 12
ENSDART00000138703 Nonsense 686 842 8 11
Genomic Location (Zv9):
Chromosome 10 (position 21503928)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21465342
GRCz11 10 21422723
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCACAGGAGGATGCTGATGTGGAATGGAAGTTTGCTCGTGCAAAGCTCT[G/A]GCTCTCGTATTTTGATGAAGGCAGCACTCTTCCAGCCCCCTTTAATCTAA
Long Flanking Sequence:
CTATACTTATACCATAATAAAACCATGTTTTAAATGTGTCAATGTTAAACATTAAAACTATTTTAAGTGTTGCTTTTTAAAAAGAGCAGTATTTTCTGCTGAAAGAAGGGCATTGGTAAACATTTAAATGTGAAGAAGTATTTGTGAATGTTTTATTATCATTTTGAATGTCTGTTGCAGGGTTGAGGAAAGCTTTAAAACACTATTCTGGTCGATCTTTGGTTTATCCGAGGTGATCTCAGTGGTCTTGAAGTACGATCACAAGTTCATTGAAAACATTGGCTATATTCTCTACGGGGTCTATAATGTCACAATGGTGGTGGTCCTCCTTAACATGCTCATAGCCATGATTAACCACTCATACCAGGAAATTGAGGTGAGCCCATGCACATTTACAATAATAAACTCAAGTATTTTGCTCTTATTGACACAGTGATGTTTGTGTGTGTGAGCACAGGAGGATGCTGATGTGGAATGGAAGTTTGCTCGTGCAAAGCTCT[G/A]GCTCTCGTATTTTGATGAAGGCAGCACTCTTCCAGCCCCCTTTAATCTAATACCCAGCCCCAAATCCTTCTATTACATGGCTCAGCGCACCAAAGCATGCCTAGTGAGTTTATGCAAGGCCAGGGTCCGCAGCAACAGCAGCCAGCAGGACATGGGAATGGCCAATTCTCGCTCTAAGGTCAGAGATCAGCGTGGGTTTTCTAACTGTTCAAATCAACAAATGGCCGTCCTTAATTTTGATATCTTTACAGCTTTATCGATTTCGACCTTACCATTCGCAAGAGGGATTCACGGTTAGAAATCCCATCAAACACCCTACACGATATCAGGTAATGATTGGATTTTGATCCAGAGACACTTCTCTGTAGGCCATTTTAAATTAAAATCCTATTCACAATCTTTTTATCGTTGTAGAAACTCATGAAGCGACTCATCAAGCGATATGTCCTGAAAGCCCAAATTGACAGTGAAAGTAATGAGATCAATGAAGGTAAGATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34888
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063619 Nonsense 701 861 8 12
ENSDART00000138703 Nonsense 692 842 8 11
Genomic Location (Zv9):
Chromosome 10 (position 21503945)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21465359
GRCz11 10 21422740
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTGGAATGGAAGTTTGCTCGTGCAAAGCTCTGGCTCTCGTATTTTGAT[G/T]AAGGCAGCACTCTTCCAGCCCCCTTTAATCTAATACCCAGCCCCAAATCC
Long Flanking Sequence:
TAAAACCATGTTTTAAATGTGTCAATGTTAAACATTAAAACTATTTTAAGTGTTGCTTTTTAAAAAGAGCAGTATTTTCTGCTGAAAGAAGGGCATTGGTAAACATTTAAATGTGAAGAAGTATTTGTGAATGTTTTATTATCATTTTGAATGTCTGTTGCAGGGTTGAGGAAAGCTTTAAAACACTATTCTGGTCGATCTTTGGTTTATCCGAGGTGATCTCAGTGGTCTTGAAGTACGATCACAAGTTCATTGAAAACATTGGCTATATTCTCTACGGGGTCTATAATGTCACAATGGTGGTGGTCCTCCTTAACATGCTCATAGCCATGATTAACCACTCATACCAGGAAATTGAGGTGAGCCCATGCACATTTACAATAATAAACTCAAGTATTTTGCTCTTATTGACACAGTGATGTTTGTGTGTGTGAGCACAGGAGGATGCTGATGTGGAATGGAAGTTTGCTCGTGCAAAGCTCTGGCTCTCGTATTTTGAT[G/T]AAGGCAGCACTCTTCCAGCCCCCTTTAATCTAATACCCAGCCCCAAATCCTTCTATTACATGGCTCAGCGCACCAAAGCATGCCTAGTGAGTTTATGCAAGGCCAGGGTCCGCAGCAACAGCAGCCAGCAGGACATGGGAATGGCCAATTCTCGCTCTAAGGTCAGAGATCAGCGTGGGTTTTCTAACTGTTCAAATCAACAAATGGCCGTCCTTAATTTTGATATCTTTACAGCTTTATCGATTTCGACCTTACCATTCGCAAGAGGGATTCACGGTTAGAAATCCCATCAAACACCCTACACGATATCAGGTAATGATTGGATTTTGATCCAGAGACACTTCTCTGTAGGCCATTTTAAATTAAAATCCTATTCACAATCTTTTTATCGTTGTAGAAACTCATGAAGCGACTCATCAAGCGATATGTCCTGAAAGCCCAAATTGACAGTGAAAGTAATGAGATCAATGAAGGTAAGATTTATCCAAAACAATCTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15708
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063619 Essential Splice Site 780 861 9 12
ENSDART00000138703 Essential Splice Site 771 842 9 11
Genomic Location (Zv9):
Chromosome 10 (position 21504258)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21465672
GRCz11 10 21423053
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAGGGATTCACGGTTAGAAATMCCATCAAACACCCTACACGATATCAG[G/T]KAATGATTGGATTTTGATCCAGAGACACTTCTCTGTAGGCCATTTYAAAT
Long Flanking Sequence:
TAACATGCTCATAGCCATGATTAACCACTCATACCAGGAAATTGAGGTGAGCCCATGCACATTTACAATAATAAACTCAAGTATTTTGCTCTTATTGACACAGTGATGTTTGTGTGTGTGAGCACAGGAGGATGCTGATGTGGAATGGAAGTTTGCTCGTGCAAAGCTCTGGCTCTCGTATTTTGATGAAGGCAGCACTCTTCCAGCCCCCTTTAATCTAATACCCAGCCCCAAATCCTTCTATTACATGGCTCAGCGCACCAAAGCATGCCTAGTGAGTTTATGCAAGGCCAGGGTCCGCAGCAACAGCAGCCAGCAGGACATGGGAATGGCCAATTCTCGCTCTAAGGTCAGAGATCAGCGTGGGTTTTCTAACTGTTCAAATCAACAAATGGCCGTCCTTAATTTTGATATCTTTACAGCTTTATCGATTTCGACCTTACCATTCGCAAGAGGGATTCACGGTTAGAAATCCCATCAAACACCCTACACGATATCAG[G/T]TAATGATTGGATTTTGATCCAGAGACACTTCTCTGTAGGCCATTTTAAATTAAAATCCTATTCACAATCTTTTTATCGTTGTAGAAACTCATGAAGCGACTCATCAAGCGATATGTCCTGAAAGCCCAAATTGACAGTGAAAGTAATGAGATCAATGAAGGTAAGATTTATCCAAAACAATCTTTTTACAATAGCTATTTTACAATTTTATCATATTCTGTGGCTAATTTGTAGTTCACGCAAAATTAAACTTCGTTATGAATATTCTATAAGGGCAGGTTATGTGGGAATAATGCTGTCATTGGTACAGAGCAAAGGGTTCAAGAGTTCTGAAATGTTTTGAAGAAACTGGACTCATTAGAAGATGTGTCCAATAGACACAATGCTCAAGCATACAGTGCATCCAGAAAGTATTCAAAGTGCTTTACTTTTTCCACATTTGTTCTAGTTACAACCTCATTCCAAAATGGGTTAAATTCATTTATTTCCTCAAAATTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9272
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063619 Essential Splice Site 780 861 9 12
ENSDART00000138703 Essential Splice Site 771 842 9 11
Genomic Location (Zv9):
Chromosome 10 (position 21504259)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21465673
GRCz11 10 21423054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAGGGATTCACGGTTAGAAATMCCATCAAACACCCTACACGATATCAGG[T/G]AATGATTGGATTTTGATCCAGAGACACTTCTCTGTAGGCCATTTYAAATT
Long Flanking Sequence:
AACATGCTCATAGCCATGATTAACCACTCATACCAGGAAATTGAGGTGAGCCCATGCACATTTACAATAATAAACTCAAGTATTTTGCTCTTATTGACACAGTGATGTTTGTGTGTGTGAGCACAGGAGGATGCTGATGTGGAATGGAAGTTTGCTCGTGCAAAGCTCTGGCTCTCGTATTTTGATGAAGGCAGCACTCTTCCAGCCCCCTTTAATCTAATACCCAGCCCCAAATCCTTCTATTACATGGCTCAGCGCACCAAAGCATGCCTAGTGAGTTTATGCAAGGCCAGGGTCCGCAGCAACAGCAGCCAGCAGGACATGGGAATGGCCAATTCTCGCTCTAAGGTCAGAGATCAGCGTGGGTTTTCTAACTGTTCAAATCAACAAATGGCCGTCCTTAATTTTGATATCTTTACAGCTTTATCGATTTCGACCTTACCATTCGCAAGAGGGATTCACGGTTAGAAATCCCATCAAACACCCTACACGATATCAGG[T/G]AATGATTGGATTTTGATCCAGAGACACTTCTCTGTAGGCCATTTTAAATTAAAATCCTATTCACAATCTTTTTATCGTTGTAGAAACTCATGAAGCGACTCATCAAGCGATATGTCCTGAAAGCCCAAATTGACAGTGAAAGTAATGAGATCAATGAAGGTAAGATTTATCCAAAACAATCTTTTTACAATAGCTATTTTACAATTTTATCATATTCTGTGGCTAATTTGTAGTTCACGCAAAATTAAACTTCGTTATGAATATTCTATAAGGGCAGGTTATGTGGGAATAATGCTGTCATTGGTACAGAGCAAAGGGTTCAAGAGTTCTGAAATGTTTTGAAGAAACTGGACTCATTAGAAGATGTGTCCAATAGACACAATGCTCAAGCATACAGTGCATCCAGAAAGTATTCAAAGTGCTTTACTTTTTCCACATTTGTTCTAGTTACAACCTCATTCCAAAATGGGTTAAATTCATTTATTTCCTCAAAATTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30937
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063619 Essential Splice Site 806 861 None 12
ENSDART00000138703 Essential Splice Site 797 842 None 11
Genomic Location (Zv9):
Chromosome 10 (position 21510062)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21471476
GRCz11 10 21428857
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGATGTATTTTCATTGAAAGAGATCAAACTGTTGTGCTTTTTCTCTTC[A/C]GGTGAGTTGAAGGAAATCAAGCAGGACATTTCCAGCCTGCGTTATGAGCT
Long Flanking Sequence:
TGTCAATAACTCAATTTTGACAAAAATGTCAGATAGAACCTTATAATTCTGAGGTGACGAATAACATTTATTTGTTGTCCACTGCAGTTTTGTTGTCTGCCTCTTTAAAGCTCAAGCTCGTTCAAGCAGGGTGGATTCTTATTAGTTTATTTTTATTATTCATGAGCTTGAAAAAAAATGTTATGAAAGGGATTCCAACGGTATCATTCCTCTGTCACCATACTTTTGATGCTGACTTTATACATTGCAAACAATTTGCAGAACTTTATTTGCATGAAAGAAGCACATCTTTTAGAGATATGTGATTCTGGAGAATATGATTCTAAATAGCATTGTGCAAATAACTAATTTTTAGAGTTCAAAAAGTGTCAAGCTATTAAGTGTTGAAAAAAACACTTATAAAAATAAGTAAACATATAAAAATTTATATATGACTATAACTCTGTTTTTGAGGATGTATTTTCATTGAAAGAGATCAAACTGTTGTGCTTTTTCTCTTC[A/C]GGTGAGTTGAAGGAAATCAAGCAGGACATTTCCAGCCTGCGTTATGAGCTCCTGGAGGAAAAATCCCAGGCCACAGAGGAGCTGGCTGAACTGATCCAGGAGCTTGGAGACAAACTCAGCAAAGGAAACAAGAGACCGTGACAAACGAACTGGTGTGAAAGTAGCTGAAAGTGTCCTAGAGCTTATTAAATTCCGAAATATTTAGTTTAGATACAAACTTTAAAGTCTTTTTATACTCTCAAGACACCAGTTTGTGAAATAGGTATGATTTGTGGTTGCCATTTGGGTGTAGGGTGCAATTTAATAAAGTAATTATAGAGCAAACTCAGGAAAACCAATAAATTCAGAAGACTCTGTTTCCTCAGAACGTATATTATTAAGACAAAAACAGCAGAACTAAGTGTGTTAGTATTAAATATTATGATAGTTCTGGAGTCCCAGCACTGTGCATTATGGTTTAGAAGGTTGGACTAATGAGATCATGTTTTAAATAAATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34889
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063619 Nonsense 841 861 11 12
ENSDART00000138703 Nonsense 832 842 11 11
Genomic Location (Zv9):
Chromosome 10 (position 21510168)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21471582
GRCz11 10 21428963
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAAAAATCCCAGGCCACAGAGGAGCTGGCTGAACTGATCCAGGAGCTT[G/T]GAGACAAACTCAGCAAAGGAAACAAGAGACCGTGACAAACGAACTGGTGT
Long Flanking Sequence:
AAAGCTCAAGCTCGTTCAAGCAGGGTGGATTCTTATTAGTTTATTTTTATTATTCATGAGCTTGAAAAAAAATGTTATGAAAGGGATTCCAACGGTATCATTCCTCTGTCACCATACTTTTGATGCTGACTTTATACATTGCAAACAATTTGCAGAACTTTATTTGCATGAAAGAAGCACATCTTTTAGAGATATGTGATTCTGGAGAATATGATTCTAAATAGCATTGTGCAAATAACTAATTTTTAGAGTTCAAAAAGTGTCAAGCTATTAAGTGTTGAAAAAAACACTTATAAAAATAAGTAAACATATAAAAATTTATATATGACTATAACTCTGTTTTTGAGGATGTATTTTCATTGAAAGAGATCAAACTGTTGTGCTTTTTCTCTTCAGGTGAGTTGAAGGAAATCAAGCAGGACATTTCCAGCCTGCGTTATGAGCTCCTGGAGGAAAAATCCCAGGCCACAGAGGAGCTGGCTGAACTGATCCAGGAGCTT[G/T]GAGACAAACTCAGCAAAGGAAACAAGAGACCGTGACAAACGAACTGGTGTGAAAGTAGCTGAAAGTGTCCTAGAGCTTATTAAATTCCGAAATATTTAGTTTAGATACAAACTTTAAAGTCTTTTTATACTCTCAAGACACCAGTTTGTGAAATAGGTATGATTTGTGGTTGCCATTTGGGTGTAGGGTGCAATTTAATAAAGTAATTATAGAGCAAACTCAGGAAAACCAATAAATTCAGAAGACTCTGTTTCCTCAGAACGTATATTATTAAGACAAAAACAGCAGAACTAAGTGTGTTAGTATTAAATATTATGATAGTTCTGGAGTCCCAGCACTGTGCATTATGGTTTAGAAGGTTGGACTAATGAGATCATGTTTTAAATAAATGTTTGTTGAATAACAATCTAAAATGTGCAAGGGGAGCTCAAAGACCTGGACAAAAATGCAATAACAGTTTAATGTTTCCTATATTTAAATTATGTATGAAGAGTACAACA
Associated Phenotype:
Not determined