Busch Lab

ZMP

usp20

Ensembl ID:
ENSDARG00000027501
ZFIN IDs:
ZDB-GENE-040426-1219, ZDB-GENE-040426-1219, ZDB-GENE-040426-1219
Description:
Ubiquitin carboxyl-terminal hydrolase 20 [Source:UniProtKB/Swiss-Prot;Acc:A5PN09]
Human Orthologue:
USP20
Human Description:
ubiquitin specific peptidase 20 [Source:HGNC Symbol;Acc:12619]
Mouse Orthologue:
Usp20
Mouse Description:
ubiquitin specific peptidase 20 Gene [Source:MGI Symbol;Acc:MGI:1921520]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa25304 Nonsense Mutation detected in F1 DNA Not yet available
sa17352 Essential Splice Site Available for shipment Available now
sa10888 Nonsense Available for shipment Available now
sa38483 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25304
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006021 Nonsense 68 913 5 25
ENSDART00000030969 Nonsense 68 88 6 7
ENSDART00000097945 Nonsense 68 898 4 24
ENSDART00000111946 Nonsense 68 340 5 11
ENSDART00000122077 Nonsense 68 340 5 14
Genomic Location (Zv9):
Chromosome 5 (position 34920311)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32702260
GRCz11 5 33302413
KASP Assay ID:
554-7343.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTACATTTTTGTACATCTGTTTATCTTCTTTTAACTATTTTCCAGGCC[A/T]AAAAGCACAATCTGACAGTAAACCTGACCACATTCAGGGTGTGGTGTTAT
Long Flanking Sequence:
TATATTTTGAAGAAAACTGTAAACCGTAAACATTGATCTGCATAGTAGGAAAAGCAAATACTATGCAAGTCAATGGTTACAGGTTTTCTACTTTCTTTAAAATATCTTTTTTTGTGTTCAACAGAAGAAAGAAACTCAAACCAGGTTTGGGACAAGTGAAGGGAAAGAAAATGGTGACAAGATTTTCAGTTTTGGGTGAACTACTTCTTTAAATGTAACATGCTCTTTTGTTTGGATAATTATGACAGAACATTGCATTATATAGGTATTCAATACAATTCATCCTTATTTTTATAGCGCTTTTAGCAAAATGTAGATTTTGTCAAAGCTGCTTAACATAAAAGTTCTAGTAAAGTCCAGATTTCAGAGTTGAAGTTCAGTTTAGTTCAGTTCAGCATGGTTTAAATTTCACTGCTGTAAGTAACAGGTGTAATAATATGTAACTCTCGAATGTACATTTTTGTACATCTGTTTATCTTCTTTTAACTATTTTCCAGGCC[A/T]AAAAGCACAATCTGACAGTAAACCTGACCACATTCAGGGTGTGGTGTTATGTCTGCGAAAGAGAGGTGTTTCTGGAACCGAAGCCTGTTACTCCTGTATCATCAGCTCACCGCTGCAAACCACATGACCAGGTAGATACGTTAGACTATTTGAAACCGCTCATAGAGTTGCACTTTTAGTATTGTGCAAAGGTTGCTGTTTGAGGTTGGCTGTCTCCTATATAATTAACATCAGTCTGGAGATCCTCTTTAGACAATGTGCTTCATAAAGGTCATGTACAATACAAGATACATAGTTCTGTCTTTTTTTGTTTCACAAAGGATCCTGTTTCGCAGACTACATGTTACCCATTGAAGGCGGTGCCTATCGCAGTGGCAGATGAGGAGGGCTCAGAGTCTGAGGAGGATGAGCTCAAACCTAGAGGTATCATGTATACTGAAAGCTGGTACATGCTACATACCATTTCAAATCTTTTAATAAATGCTAAAAGCAAGAGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17352
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006021 Essential Splice Site 207 913 8 25
ENSDART00000030969 None None 88 None 7
ENSDART00000097945 Essential Splice Site 207 898 7 24
ENSDART00000111946 Essential Splice Site 207 340 8 11
ENSDART00000122077 Essential Splice Site 207 340 8 14
Genomic Location (Zv9):
Chromosome 5 (position 34922506)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32704455
GRCz11 5 33304608
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTAAAAGCTATCAGAAGCTTATCTCTGAACTCTGGCACAAGAAACGG[T/A]AACAAGCACTGACTTGCCAGACCGYTAACGWAGATCTGGCCTGTTCTGTT
Long Flanking Sequence:
CTGAAACTTTACAGACACATTCTGGAGACACCAAAGGCTTATCTTACATCTTGTAAAAAGGGTAAAATATGTGCCCTTTATATTGTATCTTATTGTCAGTTGTTGTGTTTTCAACAGCTAAAATTCAACACTTCAAAATTAGTCATAGTAAGCTTCATTGTGTTATTTTCTAATACTCTTTACCCTTCCCAGGTCTGACAGGGATGAAAAACATTGGAAACTCTTGTTATATGAATGCTGCACTGCAGGCCTTGTCCAACTGGTAGGCTTAAAATCCTGACACAGATTTGTTGAGTGACTGATTGCACTGATTGATTTCTCAGGTCTGCGCGTCCAGCTCTTTAACTGACTTTGGGTTTCCTGCTTCTTTATATTCATTTCCCAGTCCTCCTTTGACTCAGTTTTTCCAGGATTGCAGTGGATTGGTGCGTACGGATAAGAAGCCGGCATTGTGTAAAAGCTATCAGAAGCTTATCTCTGAACTCTGGCACAAGAAACGG[T/A]AACAAGCACTGACTTGCCAGACCGTTAACGTAGATCTGGCCTGTTCTGTTGAACTTAATCTATTGATTTTGGTCATAATTAAGTATCCATATTGTTGCCTATGGCCTTTCTTTTTCTCTCTTTTGTGCTTTCTTTGGCCCTCTGTCCAGGCCGAGTTATGTTGTGCCAACTACTCTGTTTCATGGAATCAAACTGGTGAACCCCATGTTTCGTGGCTATGCTCAACAGGTATAAAGCAGTGTTATTTTAGTAAAGTCTGTATACTACTATTTCATGCAGTGCTTCCCACAGGTAAACTTTTATTGAGCTTACCGCTCAAGTATGTTAATTTTTTTTTGTATCCGCCCAATAGAACGAAACATCTACAATCGATTAAGTAGTGGAAAATCTTCTCTCGTTTACCCGTTTCATGCTCGATCTGTGTGGTTAAGACCTGTCGACCCTTTCACAGACAGTTTCACATTCTATAAACACCCACAGAGATGCGCTTTTTTTGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10888
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006021 Nonsense 507 913 13 25
ENSDART00000030969 None None 88 None 7
ENSDART00000097945 Nonsense 492 898 13 24
ENSDART00000111946 None None 340 None 11
ENSDART00000122077 None None 340 None 14
Genomic Location (Zv9):
Chromosome 5 (position 34928872)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32710821
GRCz11 5 33310974
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCATTCACCAGAGTGCACCTGTKAAAGCTGGTGTCTGCACTGATGGCTA[T/G]GCTGCACAGGGCTGGATCTCCTACATCATGGACTCTATACGAAGGTATAG
Long Flanking Sequence:
AAGAAGAAGCAGTCCCGTTTCCGTAGTGTTATTTCCGATATCTTTGATGGATCCATTCTGAGTCTTGTTCAGTGTTTGACATGTGACCGGGTGAGCAGGGATGCCAGCATCTTTTATTTTGTCTCTAGAGGGCGCCAAGCATCAAATTACATTTAAAACACTTCAAAATGCACTACTACAGTTTATTCGCGACTGTGCTCATTTATAAACCATGTAGTTCATTTAAGGTCACATCTAGAAAAAAACTGCAATGCATAGCAGCACAGAACAGCCCTTATATACATGAATCATATTGAGGATATTTTTCAAAAATACAGTATGTTTAAGACTGCAGACACACAAAAGGTTTAACAAAACTATTTGGCTTTGCAGGTTTCGACAACTGTGGAGACGTTTCAGGACCTTTCTTTGCCTATACCCGGTAAAGAAGATTTGGCTAAGCTTCATTCCTCCATTCACCAGAGTGCACCTGTTAAAGCTGGTGTCTGCACTGATGGCTA[T/G]GCTGCACAGGGCTGGATCTCCTACATCATGGACTCTATACGAAGGTATAGTAAGACAGTGATTGGACAGAGAATGAACAAAGAGTCAAAAAAGGATTTGACAAAAAGAAAAATTCACCCAAAAATGAAAATTTAGTTTTTAATTTTTCACATTTATGTTGACCTTCTTAGACCTTTATTCATCTTCAGAACAGAAATGAATCTCTTTAGCTCTTTGACCCTCCATGGACAGCAACAGTCCTAAGATGAATCTAAAACGTCAGAACATTTGGTAACGCTTTAGATTAGGTCACAATCACAGCATTAAAGGGTCATGACACCCCCACTTTCGGGTCCACCTCAGAATTTTTTCAAAAGATGCATCATAGTGGGCGTGGAGCTCCACGAGCAAAGGGCAGGAGTGGGCGTGGCCAGAAGAGCAGGGGAGAAGGAGGGGAGCGAGCAACTGTCAGTCAGTTTACAAAATGAGACACAAACCATGCGGAGACCCATGATTTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38483
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006021 Nonsense 792 913 21 25
ENSDART00000030969 None None 88 None 7
ENSDART00000097945 Nonsense 775 898 21 24
ENSDART00000111946 None None 340 None 11
ENSDART00000122077 None None 340 None 14
Genomic Location (Zv9):
Chromosome 5 (position 34936902)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32718851
GRCz11 5 33319004
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGAATCACTTATATGTGTGTGCAATTTGCCAAGTGGAGATCGAGACCT[T/A]AGCCAAACGACGGAAACTGGAGATAGACACCTTCATTAAGGTGAACAAAT
Long Flanking Sequence:
GTATGCATATATATTATTATTATTATTTTTTTTCACTTGCTGTAGCAGTGGAAACTAAAATGATATATTAATTTCTACAGGAATTCCTCCTACGAAGTACCATTATGTGGATGATCTGGTTGTGATCCTTCCTCAAAATGTGTGGGAATATCTCTACAACAGGTGAGTCATACATAGCAATGCACAAAATTGACCTTTTGGACGTCCTCAACATTTATTACCTTCTAGAACATGGGATGATACTTAAACATTTGATCTTGTCAAGTCAACAAAACCAATGCTGAACTAAAAAAAATGTGAATGGTTTTCTGCCTGATGTCATGTGCGAGGAACTCCTCTTGCCGTGCAATATAAACAATGTTGAGTTATGTGTTTGCTCTTTTCACTGGCCATACTTGTGTAATTCCTCATGTTTTGAAATATTTTTCACAGGTTTGGAGGTGGCCCGGCTGTGAATCACTTATATGTGTGTGCAATTTGCCAAGTGGAGATCGAGACCT[T/A]AGCCAAACGACGGAAACTGGAGATAGACACCTTCATTAAGGTGAACAAATGACCATTACAGAATTACAGAACTCCTGTCTGTGAGTGTGATGTTTAAAATAGGAAGTGGCATTCATGAACAGCCAAATGCCTCAGACTTTAACATGTCGCCTTGTTTTTGAGCATCAAAATTATATTGTGAGAACACACTACATGGGTTTAACTGCTGTCTTGGCCTAAAGGATGATTTATACTTTTGCCTGGGTCTGCAGCGAGACCTTCCATTGACTGCCGTGAGTTTTGCCTCGAGGCTTTCATGCTTGATGCTATTGCCATTGTACTATTTTTTAATAACAACAGGGGAGGGACTTGGAATAACTGCCCTGACGACAGTGGCGAAAAAATAGTCAGGGATTGGAGTTGTTAAATGAATTAATTGTATATAAAATGAAATTGTTTTCAGTAACTTAAATAAAATTATTAGTAAATTAGTAACTTGTGCTGCATTTTATACATCCAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8194
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006021 Nonsense 795 913 21 25
ENSDART00000030969 None None 88 None 7
ENSDART00000097945 Nonsense 778 898 21 24
ENSDART00000111946 None None 340 None 11
ENSDART00000122077 None None 340 None 14
Genomic Location (Zv9):
Chromosome 5 (position 34936910)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32718859
GRCz11 5 33319012
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTTATATGTGTGTGCWATTTGCCAAGTGGAGATCGARACCTTAGCCAAA[C/T]GACGGAAACTGGAGATAGACACCTTCATTAAGGTGAACAAATGACCATTA
Long Flanking Sequence:
ATATATTATTATTATTATTTTTTTTCACTTGCTGTAGCAGTGGAAACTAAAATGATATATTAATTTCTACAGGAATTCCTCCTACGAAGTACCATTATGTGGATGATCTGGTTGTGATCCTTCCTCAAAATGTGTGGGAATATCTCTACAACAGGTGAGTCATACATAGCAATGCACAAAATTGACCTTTTGGACGTCCTCAACATTTATTACCTTCTAGAACATGGGATGATACTTAAACATTTGATCTTGTCAAGTCAACAAAACCAATGCTGAACTAAAAAAAATGTGAATGGTTTTCTGCCTGATGTCATGTGCGAGGAACTCCTCTTGCCGTGCAATATAAACAATGTTGAGTTATGTGTTTGCTCTTTTCACTGGCCATACTTGTGTAATTCCTCATGTTTTGAAATATTTTTCACAGGTTTGGAGGTGGCCCGGCTGTGAATCACTTATATGTGTGTGCAATTTGCCAAGTGGAGATCGAGACCTTAGCCAAA[C/T]GACGGAAACTGGAGATAGACACCTTCATTAAGGTGAACAAATGACCATTACAGAATTACAGAACTCCTGTCTGTGAGTGTGATGTTTAAAATAGGAAGTGGCATTCATGAACAGCCAAATGCCTCAGACTTTAACATGTCGCCTTGTTTTTGAGCATCAAAATTATATTGTGAGAACACACTACATGGGTTTAACTGCTGTCTTGGCCTAAAGGATGATTTATACTTTTGCCTGGGTCTGCAGCGAGACCTTCCATTGACTGCCGTGAGTTTTGCCTCGAGGCTTTCATGCTTGATGCTATTGCCATTGTACTATTTTTTAATAACAACAGGGGAGGGACTTGGAATAACTGCCCTGACGACAGTGGCGAAAAAATAGTCAGGGATTGGAGTTGTTAAATGAATTAATTGTATATAAAATGAAATTGTTTTCAGTAACTTAAATAAAATTATTAGTAAATTAGTAACTTGTGCTGCATTTTATACATCCAAGCTAACTGC
Associated Phenotype:
Not determined