Busch Lab

ZMP

rpp30

Ensembl ID:
ENSDARG00000027428
ZFIN ID:
ZDB-GENE-050320-45
Description:
ribonuclease P protein subunit p30 [Source:RefSeq peptide;Acc:NP_001013497]
Human Orthologue:
RPP30
Human Description:
ribonuclease P/MRP 30kDa subunit [Source:HGNC Symbol;Acc:17688]
Mouse Orthologue:
Rpp30
Mouse Description:
ribonuclease P/MRP 30 subunit (human) Gene [Source:MGI Symbol;Acc:MGI:1859683]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa38878 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41999 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19035 Nonsense Mutation detected in F1 DNA Not yet available
sa10410 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7695
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037601 Nonsense 37 265 2 11
Genomic Location (Zv9):
Chromosome 12 (position 17522600)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16402356
GRCz11 12 16451166
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATACTTTTTGCTGTATTTTCAGTTGGCTACTCAACGGTTGCAATAAACTA[T/A]GTAGTTGAGCCACTACAGAAGAAACAGGTACAATATAGAGGAGTTAAACT
Long Flanking Sequence:
TGTAAATGGTAAAATCATATTAGCAGTCAACAACTATCAAAGTACAGCATTGTTCACAGTTTGTGAAGTGTATGCAATTTATGTCACTGAACGAATGTGTGAATATAAAACCAACTTTACCTCAATCTCCGACTATATCTATAATGCGGCGCAATAACAGTTGTATTCTCTAACGTTAGTGTTCACGTGTGTAAGCGAAGTATGAAACGTTATTAATTGTTCATACAGTGTTTATTGATATTTCCTTTTTACGTTGAATCTTGTATCAAAAGTTGTTAGTAATTGAAAACGTATTTCAACTTTTCATAATTAGCTGATTATTACTATTTACCAGCTGTCTACTGCTCCTAGCAGGATAACCAGTACGTAATGGCGATGGCTAACTTTGATTAGTTAGACTAAGAAATGCATAGATTATGCTGTACTTTTAGAGAAACCCCTAATGCTCATATACTTTTTGCTGTATTTTCAGTTGGCTACTCAACGGTTGCAATAAACTA[T/A]GTAGTTGAGCCACTACAGAAGAAACAGGTACAATATAGAGGAGTTAAACTAAACTGCATTATCGAGTTGTGCGTGCGTGTGTGTGTGTTTGTATGATGCTCTTATTTTCTTGTTTTACAGGAAATTCCTAACCCACAGAGTATTTCAGACTTATTTGATAAATTTCCAGTTGTCCAGGTAATTAGCTTAAACATATCTTCCGAGATAATTAACAATGATGTGTTCTTTTTAATTAATTTTTTTCTTCTGTTATAGGGCAAATCTTCTCCAATCAAAGTGCTAAATCGATTGACCATTGTGGCATCTGATGCATCACATTTTGTAAGTTTATACTTCGTAAACTCTAATATAATTTGTGCTAAAGTATTATACACATTATATTGTATTATATACTGCAGTATTATATGGTGAGACTGTTTGTGTTATTCTCCTTAGAGACCTACTAATGAATACAAAAAATTTGACCTTGTGGCGGTGTACCCCAAAACTGAAAAGCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38878
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037601 Essential Splice Site 46 265 2 11
Genomic Location (Zv9):
Chromosome 12 (position 17522571)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16402327
GRCz11 12 16451137
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAACGGTTGCAATAAACTATGTAGTTGAGCCACTACAGAAGAAACAGG[T/C]ACAATATAGAGGAGTTAAACTAAACTGCATTATCGAGTTGTGCGTGCGTG
Long Flanking Sequence:
ACAACTATCAAAGTACAGCATTGTTCACAGTTTGTGAAGTGTATGCAATTTATGTCACTGAACGAATGTGTGAATATAAAACCAACTTTACCTCAATCTCCGACTATATCTATAATGCGGCGCAATAACAGTTGTATTCTCTAACGTTAGTGTTCACGTGTGTAAGCGAAGTATGAAACGTTATTAATTGTTCATACAGTGTTTATTGATATTTCCTTTTTACGTTGAATCTTGTATCAAAAGTTGTTAGTAATTGAAAACGTATTTCAACTTTTCATAATTAGCTGATTATTACTATTTACCAGCTGTCTACTGCTCCTAGCAGGATAACCAGTACGTAATGGCGATGGCTAACTTTGATTAGTTAGACTAAGAAATGCATAGATTATGCTGTACTTTTAGAGAAACCCCTAATGCTCATATACTTTTTGCTGTATTTTCAGTTGGCTACTCAACGGTTGCAATAAACTATGTAGTTGAGCCACTACAGAAGAAACAGG[T/C]ACAATATAGAGGAGTTAAACTAAACTGCATTATCGAGTTGTGCGTGCGTGTGTGTGTGTTTGTATGATGCTCTTATTTTCTTGTTTTACAGGAAATTCCTAACCCACAGAGTATTTCAGACTTATTTGATAAATTTCCAGTTGTCCAGGTAATTAGCTTAAACATATCTTCCGAGATAATTAACAATGATGTGTTCTTTTTAATTAATTTTTTTCTTCTGTTATAGGGCAAATCTTCTCCAATCAAAGTGCTAAATCGATTGACCATTGTGGCATCTGATGCATCACATTTTGTAAGTTTATACTTCGTAAACTCTAATATAATTTGTGCTAAAGTATTATACACATTATATTGTATTATATACTGCAGTATTATATGGTGAGACTGTTTGTGTTATTCTCCTTAGAGACCTACTAATGAATACAAAAAATTTGACCTTGTGGCGGTGTACCCCAAAACTGAAAAGCTCTTTCATGTAAGTGTAGTTTCAATTCTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41999
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037601 Essential Splice Site 87 265 4 11
Genomic Location (Zv9):
Chromosome 12 (position 17522277)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16402033
GRCz11 12 16450843
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAAGTGCTAAATCGATTGACCATTGTGGCATCTGATGCATCACATTTTG[T/C]AAGTTTATACTTCGTAAACTCTAATATAATTTGTGCTAAAGTATTATACA
Long Flanking Sequence:
CTATTTACCAGCTGTCTACTGCTCCTAGCAGGATAACCAGTACGTAATGGCGATGGCTAACTTTGATTAGTTAGACTAAGAAATGCATAGATTATGCTGTACTTTTAGAGAAACCCCTAATGCTCATATACTTTTTGCTGTATTTTCAGTTGGCTACTCAACGGTTGCAATAAACTATGTAGTTGAGCCACTACAGAAGAAACAGGTACAATATAGAGGAGTTAAACTAAACTGCATTATCGAGTTGTGCGTGCGTGTGTGTGTGTTTGTATGATGCTCTTATTTTCTTGTTTTACAGGAAATTCCTAACCCACAGAGTATTTCAGACTTATTTGATAAATTTCCAGTTGTCCAGGTAATTAGCTTAAACATATCTTCCGAGATAATTAACAATGATGTGTTCTTTTTAATTAATTTTTTTCTTCTGTTATAGGGCAAATCTTCTCCAATCAAAGTGCTAAATCGATTGACCATTGTGGCATCTGATGCATCACATTTTG[T/C]AAGTTTATACTTCGTAAACTCTAATATAATTTGTGCTAAAGTATTATACACATTATATTGTATTATATACTGCAGTATTATATGGTGAGACTGTTTGTGTTATTCTCCTTAGAGACCTACTAATGAATACAAAAAATTTGACCTTGTGGCGGTGTACCCCAAAACTGAAAAGCTCTTTCATGTAAGTGTAGTTTCAATTCTACATTGTGTTTTAGTTTTAGTTGAGGTTTAGTTCACCCTAAAATGAAAATGAGTTACTCACCCACACGGCATCTTATATGCCTTACCTTTCACTCAAATTCAATTGAAGTTATTTAAAAATGTAGGATTTCCAGCTCTGCAATGGTAAATGTCAGCTGATTATCAGCAGTCCAAAAGAATTCCAATAAAGTGCATCATCCATAATAAAAAGTGCCTAACCCTAGTGAACTAACCCTTTACATTTTGGATAATGGGTAATTAGTTTATCATTTTTGATTTATATTTATATATATATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19035
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037601 Nonsense 222 265 10 11
ENSDART00000037601 Nonsense 222 265 10 11
Genomic Location (Zv9):
Chromosome 12 (position 17518209)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16397919
GRCz11 12 16446729
KASP Assay ID:
2260-5187.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTCAGCTTGTCTGAGGGGGACGCTAAAGCTGCTGTGTCAACTAACTGT[C/T]GATCTGTCTTGCTACATGGAGGTAAATAATTGAAACTATAAGTCTCACTC
Long Flanking Sequence:
GCAATCAGAGACTCCATTACAAGGAGATACACCATTGCCAATGCAATCTGCCTAATGGAAATTTGCAAAGGAAAAGTATGTTCTTCCTTTTTACACATAAACTTCTATAATATATAATAATGTATTATGCTGATTTTGGATTTTTTTCCCTCACAAAAAGAATGTCATAGTGTCCAGTGGAGCAGAAAGGGTAAAATGTCTTTACAATTTAATAGAGTGAATCATTTATAAAATTGTAAAGTATTATATATTTATAATGTTGTAAGCTCAGTGTTACATTTGTCTATTGTTTTTGTTTCTTCAGCAACTTGAACTGAGGGGCCCATATGACATTGCCAATTTGTATCCTTTTTAACAAGTGTATGGATAAGTTATTTAAATATGCAGTGGGACTTGTAAGGCACTGTATCCGTGTTGGAATGTTCCTTCATTGAGACTACAGGGGGCTTGTTTTCAGCTTGTCTGAGGGGGACGCTAAAGCTGCTGTGTCAACTAACTGT[C/T]GATCTGTCTTGCTACATGGAGGTAAATAATTGAAACTATAAGTCTCACTCTTTGCCTTTTTTTCCAGTAAATAGTTACATTATTAGATTTGTTAATATGCAATTCTTCTATTACAGAAACTAGAGCAACTGCATCTGGTGTTATTCACACCATGAAGAAACCACAAATTCTCCAGAAGGAAGAAGAGGAAACTCCGGCTGCCAAAAAAGCCAGAACTGAACTAGCCTAAATAGCATTTCAGCTAGAGTTTTTACTAAATCCTGTTTGTTTTTTCAAATATATCATAATGTAAAACTTTTTTGTTACTTCTCAAAGTCTTGCAAATCACTTTAAAAAATGAAAGATGACGCAGATGTGTTAAAAATGTATTTTATTAGTTAAGGTTTAATGGAATTGCAAGCAAAATTTACATATAATAGTACAAAAATTCTTATGTCATATTCTGTACAGACGTCATGCACAAAAAGCACATTCTGTAATAAAGTTTTGGAATATCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10410
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037601 Nonsense 222 265 10 11
ENSDART00000037601 Nonsense 222 265 10 11
Genomic Location (Zv9):
Chromosome 12 (position 17518209)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16397919
GRCz11 12 16446729
KASP Assay ID:
2260-5187.1 (used for ordering genotyping assays)
KASP Sequence:
TTTTCAGCTTGTCTGAGGGGGACGCTAAAGCTGCTGTGTCAACTAACTGT[C/T]GATCTGTCTTGCTACATGGAGGYAAATAAKTGAAACTATAAGTCTCACTC
Long Flanking Sequence:
GCAATCAGAGACTCCATTACAAGGAGATACACCATTGCCAATGCAATCTGCCTAATGGAAATTTGCAAAGGAAAAGTATGTTCTTCCTTTTTACACATAAACTTCTATAATATATAATAATGTATTATGCTGATTTTGGATTTTTTTCCCTCACAAAAAGAATGTCATAGTGTCCAGTGGAGCAGAAAGGGTAAAATGTCTTTACAATTTAATAGAGTGAATCATTTATAAAATTGTAAAGTATTATATATTTATAATGTTGTAAGCTCAGTGTTACATTTGTCTATTGTTTTTGTTTCTTCAGCAACTTGAACTGAGGGGCCCATATGACATTGCCAATTTGTATCCTTTTTAACAAGTGTATGGATAAGTTATTTAAATATGCAGTGGGACTTGTAAGGCACTGTATCCGTGTTGGAATGTTCCTTCATTGAGACTACAGGGGGCTTGTTTTCAGCTTGTCTGAGGGGGACGCTAAAGCTGCTGTGTCAACTAACTGT[C/T]GATCTGTCTTGCTACATGGAGGTAAATAATTGAAACTATAAGTCTCACTCTTTGCCTTTTTTTCCAGTAAATAGTTACATTATTAGATTTGTTAATATGCAATTCTTCTATTACAGAAACTAGAGCAACTGCATCTGGTGTTATTCACACCATGAAGAAACCACAAATTCTCCAGAAGGAAGAAGAGGAAACTCCGGCTGCCAAAAAAGCCAGAACTGAACTAGCCTAAATAGCATTTCAGCTAGAGTTTTTACTAAATCCTGTTTGTTTTTTCAAATATATCATAATGTAAAACTTTTTTGTTACTTCTCAAAGTCTTGCAAATCACTTTAAAAAATGAAAGATGACGCAGATGTGTTAAAAATGTATTTTATTAGTTAAGGTTTAATGGAATTGCAAGCAAAATTTACATATAATAGTACAAAAATTCTTATGTCATATTCTGTACAGACGTCATGCACAAAAAGCACATTCTGTAATAAAGTTTTGGAATATCAAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4460
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037601 Essential Splice Site 229 265 10 11
Genomic Location (Zv9):
Chromosome 12 (position 17518186)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16397896
GRCz11 12 16446706
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTAAAGCTGCTGTGTCAACTAACTGTCGATCTGTCTTGCTACATGGAGG[T/C]AAATAATTGAAACTATAAGTCTCACTCTTTGCCTTTTTTTCCAGTAAATA
Long Flanking Sequence:
GAGATACACCATTGCCAATGCAATCTGCCTAATGGAAATTTGCAAAGGAAAAGTATGTTCTTCCTTTTTACACATAAACTTCTATAATATATAATAATGTATTATGCTGATTTTGGATTTTTTTCCCTCACAAAAAGAATGTCATAGTGTCCAGTGGAGCAGAAAGGGTAAAATGTCTTTACAATTTAATAGAGTGAATCATTTATAAAATTGTAAAGTATTATATATTTATAATGTTGTAAGCTCAGTGTTACATTTGTCTATTGTTTTTGTTTCTTCAGCAACTTGAACTGAGGGGCCCATATGACATTGCCAATTTGTATCCTTTTTAACAAGTGTATGGATAAGTTATTTAAATATGCAGTGGGACTTGTAAGGCACTGTATCCGTGTTGGAATGTTCCTTCATTGAGACTACAGGGGGCTTGTTTTCAGCTTGTCTGAGGGGGACGCTAAAGCTGCTGTGTCAACTAACTGTCGATCTGTCTTGCTACATGGAGG[T/C]AAATAATTGAAACTATAAGTCTCACTCTTTGCCTTTTTTTCCAGTAAATAGTTACATTATTAGATTTGTTAATATGCAATTCTTCTATTACAGAAACTAGAGCAACTGCATCTGGTGTTATTCACACCATGAAGAAACCACAAATTCTCCAGAAGGAAGAAGAGGAAACTCCGGCTGCCAAAAAAGCCAGAACTGAACTAGCCTAAATAGCATTTCAGCTAGAGTTTTTACTAAATCCTGTTTGTTTTTTCAAATATATCATAATGTAAAACTTTTTTGTTACTTCTCAAAGTCTTGCAAATCACTTTAAAAAATGAAAGATGACGCAGATGTGTTAAAAATGTATTTTATTAGTTAAGGTTTAATGGAATTGCAAGCAAAATTTACATATAATAGTACAAAAATTCTTATGTCATATTCTGTACAGACGTCATGCACAAAAAGCACATTCTGTAATAAAGTTTTGGAATATCAAATCACACCTATCATTCATGATTTAA
Associated Phenotype:
Not determined