Busch Lab

ZMP

slc25a3l

Ensembl ID:
ENSDARG00000027424
ZFIN ID:
ZDB-GENE-040426-1673
Description:
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3, like [Source:RefSeq
Human Orthologue:
SLC25A3
Human Description:
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 [Source:HGNC Symbol;Ac
Mouse Orthologue:
Slc25a3
Mouse Description:
solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3 Gene [Source:MGI Symbo

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20249 Essential Splice Site Available for shipment Available now
sa33436 Nonsense Mutation detected in F1 DNA Not yet available
sa31392 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20249
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037949 Essential Splice Site 169 377 5 8
ENSDART00000125743 Essential Splice Site 164 372 5 8
Genomic Location (Zv9):
Chromosome 4 (position 15917899)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16860739
GRCz11 4 16849715
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTAAATTTAGCAGTAGATCACCCACTAACTGTTTGTGTTTGGCAAACA[G/T]GAGAATGCTTATTTGTGGAGGACATCCGTTTATCTGGCCGCCTCTGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33436
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037949 Nonsense 235 377 6 8
ENSDART00000125743 Nonsense 230 372 6 8
Genomic Location (Zv9):
Chromosome 4 (position 15916880)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16859720
GRCz11 4 16848696
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGTTTGCTAATGATGTTATTGTCTGTGCAGCTTCTATAAAGGTGTTTA[T/A]CCGCTGTGGCTGAGGCAGATTCCTTACACCATGATGAAGTTTGCTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31392
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037949 Nonsense 257 377 6 8
ENSDART00000125743 Nonsense 252 372 6 8
Genomic Location (Zv9):
Chromosome 4 (position 15916816)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16859656
GRCz11 4 16848632
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAGATTCCTTACACCATGATGAAGTTTGCTTGTTTCGAGCGAACGGTG[G/T]AAACTCTGTACAAGTACGTCGTACCCAAACCCCGCAGTGAGTGCTCCAAA
Associated Phenotype:
Not determined